# Source paper archive - Source title: RabA- and RabE-mediated trafficking define distinct branches of plant pre-invasive immunity - Author(s): Nielsen, M. E., Mensch, J., Munch, D. H., Rubiato, H. M. - Source landing URL: https://www.biorxiv.org/content/10.64898/2026.11.10.765595v1 - PDF URL: https://www.biorxiv.org/content/10.64898/2026.11.10.765595v1.full.pdf - PDF SHA-256: cc599d555495692bb1a255e48c626982e75b82048d6f78baa6f9385b7da7bcda - Converter: pymupdf4llm 0.0.27 - Limits: Automated PDF text extraction; reading order, equations, tables and formatting may be incomplete or incorrect. Images are omitted, and no OCR was performed. Markup and links are neutralized for safe downloading. Consult the original PDF for the authoritative version. --- [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 1 **Title** 2 RabA- and RabE-mediated trafficking define distinct branches of plant pre-invasive immunity 3 4 **Running title** 5 Distinct trafficking modules in pre-invasive immunity. 6 7 **Authors** 8 Mads Eggert Nielsen [1,*], Jelco Mensch [1], David Havndrup Munch [1] and Héctor Molinelli 9 Rubiato [1,2] 10 11 **Affiliations** 12 1 University of Copenhagen, Faculty of Science, CPSC, Department of Plant and Environmental 13 Sciences, 1871 Frederiksberg C, Denmark 14 2 Current address: Universidad Politécnica de Madrid, Campus de Montegancedo, Centre for 15 Plant Biotechnology and Genomics (UPM-INIA), Madrid, Spain 16 - Corresponding author: Mads Eggert Nielsen: maen@plen.ku.dk 17 18 **ORCIDs** 19 Mads E. Nielsen https://orcid.org/0000-0001-6170-8836 20 Jelco Mensch https://orcid.org/0009-0004-3620-0124 21 David H. Munch https://orcid.org/0000-0002-4429-8393 22 Héctor M. Rubiato https://orcid.org/0000-0002-0432-0162 23 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 24 **Abstract** 25 Pre-invasive immunity constitutes a major barrier to disease and protects plants against the vast 26 majority of filamentous fungal and oomycete pathogens through localized defence responses 27 at sites of attempted invasion. Although membrane trafficking is essential for these responses, 28 demonstrated by the requirement for the syntaxins PEN1 and SYP122, the underlying 29 trafficking pathways remain poorly understood. Here, we show that trafficking mediated by the 30 RabE and RabA GTPase subfamilies defines two functionally distinct branches of plant pre 31 invasive immunity. Inhibition of RabE rapidly compromised immunity to powdery mildew 32 fungi, including the durable immunity conferred by _mlo_ mutations, and reduced focal 33 accumulation of PEN1 at papillae without substantially affecting callose deposition. By 34 contrast, inhibition of RabA disrupted plasma membrane localization of multiple proteins and 35 preferentially compromised immunity to the oomycete pathogen _Phytophthora infestans_ . 36 Together, these findings support a model in which RabE promotes the powdery mildew-specific 37 function of PEN1 in pre-invasive immunity, whereas RabA contributes to a broader defence 38 pathway associated with the shared function of PEN1 and SYP122. Our results support a model 39 in which pre-invasive immunity is coordinated by specialized trafficking modules with distinct 40 pathogen requirements and establish RabA- and RabE-mediated trafficking as defining 41 components of these pathways. 42 43 **Introduction** 44 Filamentous fungal and oomycete pathogens invade plant tissues by breaching the epidermal 45 cell wall and are responsible for some of the most destructive diseases in natural and 46 agricultural ecosystems (Savary et al., 2019). To counter invasion, plants have evolved highly 47 effective pre-invasive defence mechanisms that are activated upon pathogen attack (Nielsen, 48 2024). These responses are characterized by the focal assembly of papillae beneath attempted 49 penetration sites and the formation of encasements around invasive structures following 50 successful ingress (O’Connell and Panstruga, 2006). Together, these cell-autonomous defence 51 structures contribute to the remarkable durability of nonhost resistance towards a wide range 52 of filamentous pathogens (Panstruga and Moscou, 2020). The importance of these responses is 53 underscored by the observation that loss of the two closely related SYP12-clade syntaxins 54 PENETRATION1 (PEN1; syntaxin in plants121, SYP121) and SYP122 abolishes papilla and 55 encasement formation and compromises immunity to phylogenetically diverse fungal and 56 oomycete pathogens in _Arabidopsis thaliana_ (Rubiato et al., 2022). [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 57 PEN1 and SYP122 are members of the soluble N-ethylmaleimide-sensitive factor attachment 58 protein receptor (SNARE) family, and their requirement for papilla and encasement formation 59 demonstrates that these defence structures depend on polarized membrane trafficking. 60 Although PEN1 and SYP122 share an overlapping role in the assembly of these defence 61 structures and in the establishment of broad-spectrum immunity, genetic analyses have 62 revealed an additional specialized function of PEN1 during interactions with powdery mildew 63 fungi (Rubiato et al., 2022). In contrast to SYP122, PEN1 is required for rapid pre-invasive 64 immunity towards powdery mildew fungi and has been proposed to participate in a highly 65 dynamic trafficking route that enables focal delivery of defence cargo to sites of fungal attack 66 (Collins et al., 2003; Assaad et al., 2004). This functional distinction suggests that general pre 67 invasive immunity and powdery mildew-specific immunity may rely on partially separate 68 membrane trafficking pathways delivering the anti-microbial cargo that blocks the pathogen 69 (Nielsen and Thordal-Christensen, 2013; Hansen and Nielsen, 2017; Nielsen, 2024). 70 Consistent with this idea, we recently proposed that pre-invasive immunity comprises at least 71 two genetically separable trafficking pathways defined by specific ADP-ribosylation factor 72 guanine nucleotide exchange factors (ARF-GEFs) required for vesicle budding (Richter et al., 73 2014; Brumm et al., 2020). A broadly acting pathway, associated with the shared immune 74 function of PEN1 and SYP122, requires BIG1-BIG4 and contributes to immunity against 75 diverse filamentous pathogens (Munch _et al_ ., 2026). In contrast, a GNOM-dependent pathway 76 is specifically associated with the specialized function of PEN1 during powdery mildew attack 77 (Nielsen et al., 2012; Nielsen et al., 2017). These findings raise the possibility that distinct 78 membrane trafficking regulators define general and powdery mildew-specific immune 79 pathways. However, the molecular machinery acting downstream of BIG1-BIG4 and GNOM 80 remains largely unknown. 81 Rab GTPases are master regulators of vesicle trafficking and membrane identity that help 82 ensure correct SNARE assembly and thereby confer specificity to cargo delivery (Stenmark, 83 2009). In plants, extensive genetic redundancy within Rab subfamilies has often hindered the 84 identification of individual members that contribute to specific membrane trafficking pathways 85 (Nielsen, 2020). Instead, dominant-negative Rab variants have provided important insights into 86 subfamily functions. In this way, members of the RabA and RabE subfamilies have been shown 87 to regulate secretion, recycling, and polarized membrane transport at the plasma membrane, 88 processes that are central to the delivery of defence cargo during pathogen attack (Zheng et al., 89 2005; Chow et al., 2008; Speth et al., 2009; Orr et al., 2021; Pang et al., 2022; Koch et al., 90 2026). In support of this, both RabA and RabE dependent secretion is required for resistance [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 91 against different species of the pathogenic oomycete _Phytophthora_ (Tomczynska et al., 2018; 92 Li et al., 2022; Pandey et al., 2021; Yuen et al., 2024). However, whether RabA and RabE 93 GTPases directly control pre-invasive immunity, and how they connect to the shared and 94 specialized immune functions of PEN1 and SYP122, remains unknown. 95 Here, we show that RabA- and RabE-mediated trafficking define distinct branches of plant pre 96 invasive immunity. RabE-dependent trafficking is specifically required for immunity to 97 powdery mildew fungi and contributes to durable MILDEW RESISTANCE LOCUS O ( _mlo_ ) 98 mediated immunity, whereas RabA-dependent trafficking preferentially contributes to 99 immunity against the oomycete pathogen _Phytophthora infestans_ . These findings identify 100 RabA and RabE as defining components of two genetically and functionally distinct immune 101 trafficking pathways. We propose that RabE acts in a pathway associated with the specialized 102 function of PEN1 during powdery mildew attack, whereas RabA contributes to a broader 103 immune pathway linked to the shared function of PEN1 and SYP122. Together, our results 104 provide a mechanistic framework for understanding how plants deploy specialized membrane 105 trafficking routes to counter diverse filamentous pathogens. 106 107 **Results** 108 **RabA-mediated trafficking contributes to pre-invasive immunity only after prolonged** 109 **inhibition** 110 Recently, RabA2a was directly linked to PEN1 and SYP122 and found required for their proper 111 localization suggesting a role in defence-associated membrane trafficking (Pang et al., 2022). 112 To assess a potential role for RabA in pre-invasive immunity against non-adapted powdery 113 mildew fungi, we employed dexamethasone (DEX)-inducible dominant-negative variants of 114 RabA2a previously described by Chow et al. (2008). Constitutively active RabA2a (QL) plants 115 displayed severe developmental defects even in the absence of induction and were therefore 116 excluded from subsequent analyses. We initially induced expression of the dominant-negative 117 alleles RabA2a (SN) and RabA2a (NI) for 3 h before inoculation with _Blumeria hordei_ . Under 118 these conditions, penetration frequencies did not differ significantly from those of control 119 plants (Supplementary Fig. 1a). By contrast, repeated DEX treatments administered 48 h, 24 h 120 and 3 h before inoculation resulted in a marked increase in fungal penetration, demonstrating 121 that prolonged inhibition of RabA compromises pre-invasive immunity (Fig. 1a). RabA2a (NI) 122 caused a stronger phenotype than RabA2a (SN), consistent with previous reports (Chow et al., 123 2008). Notably, prolonged induction of RabA2a (NI) also impaired callose accumulation at 124 both unsuccessful penetration attempts (papillae) and successful penetration sites [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 125 (encasements) (Fig. 1b-g; Supplementary Fig. 1b). The resulting phenotype closely resembled 126 the defective cell wall responses previously described in _pen1 syp122_ mutants (Rubiato et al., 127 2022). Together, these data indicate that RabA function contributes to powdery mildew 128 immunity but that substantial inhibition is required before defects in pre-invasive immunity 129 and callose deposition become apparent. 130 131 **RabA maintains plasma membrane localization of selected proteins** 132 The requirement for prolonged RabA inhibition to affect pre-invasive immunity contrasts with 133 reports that RabA disruption rapidly alters PEN1 localization (Pang et al., 2022). To investigate 134 this discrepancy, we monitored GFP-PEN1 after induction of RabA2a (NI). Strikingly, GFP 135 PEN1 localization was already strongly affected 24 h after induction, well before measurable 136 defects in pre-invasive immunity were observed (Fig. 2a). Following prolonged induction, 137 PEN1 became progressively depleted from the plasma membrane and instead accumulated on 138 intracellular membranes frequently associated with fragmented vacuoles (Fig. 2b). Co 139 expression with the tonoplast marker Vesicle-associated membrane protein 711 (VAMP711) 140 confirmed substantial relocalization of PEN1 to vacuolar membranes, whereas no comparable 141 accumulation was detected in compartments marked by ARA7 or 2xFYVE (Supplementary 142 Fig. 2). 143 A similar temporal pattern was observed for GFP-SYP122 (Fig. 2b-d). Moreover, RabA2a (NI) 144 altered the localization of several additional plasma membrane-associated proteins, including 145 MLO2, Tetraspanin8 (TET8) and PEN3, within 24 h of induction (Supplementary Fig. 3a-f). 146 In contrast, the plasma membrane syntaxin SYP132 remained largely unaffected, and secretion 147 of secRFP was only weakly perturbed even after prolonged induction (Fig. 2e,f; Supplementary 148 Fig. 3g,h). 149 These observations demonstrate that inhibition of RabA rapidly disrupts the plasma membrane 150 localization of a specific subset of proteins, including several previously implicated in plant 151 immunity. Yet these trafficking defects preceded detectable reductions in pre-invasive 152 immunity, revealing a striking temporal disconnect between plasma membrane protein 153 localization and penetration resistance. This finding suggests that RabA primarily maintains 154 plasma membrane homeostasis rather than directly mediating immune trafficking. We therefore 155 asked whether other Rab GTPases contribute more directly to pre-invasive immunity. 156 157 **RabE is required for immunity against non-adapted powdery mildew fungi** [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 158 RabE proteins are plant homologues of the Rab8 family that promote secretion toward the 159 plasma membrane (Zheng et al., 2005; Koch et al., 2026). To examine whether RabE-dependent 160 trafficking contributes to pre-invasive immunity, we analysed YFP-RabE1d, which localized 161 predominantly to intracellular puncta distinct from mCherry-RabA2a-positive structures with 162 some overlap at the plasma membrane (Supplementary Fig. 4a,b). In response to attack by _B._ 163 _hordei_, RabA2a and RabE1d showed only little enrichment in papillae or encasements, 164 suggesting functions upstream of focal cargo delivery rather than accumulating directly within 165 defence structures (Fig. 3a,b). 166 To compare the roles of RabA and RabE directly, we generated estradiol (EST)-inducible 167 dominant-negative RabE1d (NI) and RabA2a (NI) lines in a GFP-PEN1 background. In line 168 with previous reports, prolonged induction of either construct severely affected plant growth 169 (Supplementary Fig. 4c). However, unlike RabA2a (NI), induction of RabE1d (NI) for 24 h did 170 not visibly alter GFP-PEN1 localization (Supplementary Fig. 4d). 171 Despite the absence of obvious PEN1 trafficking defects, induction of RabE1d (NI) only 3 h 172 before inoculation significantly increased penetration frequencies of _B. hordei_, whereas 173 equivalent induction of RabA2a (NI) had no detectable effect (Fig. 3c). Consistent with this 174 finding, the temperature-sensitive mutation stomatal cytokinesis-defective 1-1 ( _scd1_ ), affecting 175 a RabE guanine nucleotide exchange factor, likewise compromised pre-invasive immunity at 176 the restrictive temperature (Fig. 3d). Unexpectedly, neither RabE1d (NI) expression nor loss of 177 SCD1 substantially affected pathogen-induced callose deposition (Fig. 3e-g; Supplementary 178 Fig. 5). Thus, RabE-dependent trafficking contributes directly to pre-invasive immunity against 179 non-adapted powdery mildew fungi and can be genetically uncoupled from callose deposition. 180 181 **RabE promotes focal accumulation of PEN1 at sites of fungal attack** 182 Because callose deposition remained largely intact following RabE inhibition, we investigated 183 the recruitment of defence-associated plasma membrane proteins to attack sites. In wild-type 184 plants, both PEN1 and PEN3 accumulated at papillae, although PEN1 exhibited a substantially 185 higher papilla-to-plasma membrane fluorescence ratio (Fig. 4). Expression of RabA2a (NI) 186 reduced PEN1 accumulation at papillae, but interpretation was complicated by broader defects 187 in plasma membrane localization. In contrast, dominant-negative RabE1d produced a more 188 selective phenotype. PEN1 accumulation at papillae was consistently reduced, whereas PEN3 189 recruitment was comparatively unaffected (Fig. 4). Similar defects were observed in _scd1_ 190 mutants (Supplementary Fig. 6a-c). Notably, PEN1 accumulation at encasements remained 191 largely unaffected, indicating that distinct trafficking pathways contribute to PEN1 recruitment [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 192 during different stages of defence (Supplementary Fig.6d-f). Together, these data identify 193 PEN1 focal accumulation, rather than callose deposition, as the cellular process most closely 194 associated with RabE-dependent pre-invasive immunity. 195 196 **RabA and RabE regulate distinct branches of pre-invasive immunity** 197 Previously, we proposed that plant pre-invasive immunity towards filamentous pathogens 198 involves at least two mechanistically distinct trafficking pathways, where one acts broadly 199 against fungi and oomycetes, and the other is dedicated towards powdery mildew fungi 200 specifically (Rubiato et al., 2022; Munch et al., 2026). To determine whether RabA and RabE 201 contribute differentially to these pre-invasive immunity pathways, we challenged induced 202 plants with spores from the oomycete pathogen _P. infestans_ . In contrast to the strong effects 203 observed during interaction with _B. hordei_, inhibition of RabE did not increase penetration by 204 _P. infestans_ . In contrast, RabA2a(NI) markedly compromised immunity to the oomycete 205 pathogen, demonstrating that RabA- and RabE-mediated trafficking underpin distinct branches 206 of pre-invasive immunity (Fig. 5a, Supplementary Video 1). Likewise, shifting _scd1_ plants to 207 the restrictive temperature did not alter penetration rates of _P. infestans_ (Fig. 5b). Despite 208 enhanced pathogen entry, host cells expressing RabA2a (NI) retained the ability to mount 209 localized defence responses. (Fig. 5c-e). These findings establish that RabA- and RabE 210 mediated trafficking pathways make differential contributions to pre-invasive immunity 211 against non-adapted fungal and oomycete pathogens. 212 213 **RabE-dependent trafficking contributes to** _**mlo**_ **-based powdery mildew immunity** 214 Recently, we have shown that the near complete immunity to the adapted powdery mildew 215 fungus _Golovinomyces orontii_ in the _mlo2 mlo6 mlo12_ mutant requires PEN1 and SYP122 216 (Munch et al., 2026). To assess whether Rab-dependent trafficking also contributes to this 217 durable _mlo_ -mediated immunity, we introduced inducible RabA2a (NI) and RabE1d (NI) into 218 the highly resistant _mlo2 mlo6 mlo12_ background. Whereas inhibition of RabA had no 219 measurable impact on pre-invasive immunity to the adapted powdery mildew fungus _G. orontii_, 220 expression of RabE1d (NI) significantly increased successful penetration events (Fig. 6a). 221 The _mlo2 mlo6 mlo12_ mutant displayed enhanced callose accumulation following fungal 222 attack, but this response was largely unaffected by inhibition of either RabA or RabE (Fig. 6b,c; 223 Supplementary Fig. 7a,b, Supplementary Video 2 ). Similarly, robust callose encasements 224 formed around developing haustoria in the successful infections observed (Fig. 6d,e; [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 225 Supplementary Fig. 7c,d). Thus, RabE-dependent trafficking contributes to both nonhost and 226 _mlo_ -mediated powdery mildew immunity independently of major effects on callose deposition. 227 To find support for our observations, we crossed the temperature sensitive _scd1_ allele into the 228 _mlo2 mlo6 mlo12_ triple mutant. However, we repeatedly failed to find successful penetrations 229 in the _mlo2 mlo6 mlo12_ triple mutant and only rarely when in combination with the _scd1_ 230 mutation in the restrictive temperature (Supplementary Fig.7e,f). The complete absence of 231 penetrations in the _mlo2 mlo6 mlo12_ mutant suggests that an increase in temperature negatively 232 affects the powdery mildew fungus and thereby masks the effect of _scd1_ . 233 234 **Discussion** 235 Pre-invasive immunity relies on the rapid delivery of defence components to sites of attempted 236 pathogen ingress, yet the trafficking pathways underlying these responses remain poorly 237 defined (Nielsen, 2024). Here, we show that members of the RabA and RabE subfamilies make 238 distinct contributions to plant pre-invasive immunity. RabE-mediated trafficking is required for 239 immunity to powdery mildew fungi, whereas RabA-dependent trafficking contributes 240 predominantly to immunity against the oomycete pathogen _P. infestans_ . These findings suggest 241 that pre-invasive immunity is mediated by specialized trafficking pathways rather than a single 242 general defence route. 243 Several observations support a direct role for RabE-mediated trafficking in powdery mildew 244 immunity. Inhibition of RabE rapidly increased penetration by _B. hordei_, whereas equivalent 245 inhibition of RabA had little effect. Likewise, loss of the RabE GEF SCD1 compromised 246 immunity to _B. hordei_, and RabE inhibition partially overcame the durable immunity conferred 247 by the _mlo2 mlo6 mlo12_ triple mutant. Notably, these effects occurred without major reductions 248 in callose accumulation and thus underlines our previous observations that callose 249 accumulation correlates poorly with immunity (Munch et al., 2026). Instead, susceptibility 250 correlated with reduced accumulation of PEN1 at papillae, suggesting that focal delivery of 251 defence-associated membrane components is a key determinant of powdery mildew immunity. 252 The selective involvement of RabE is particularly intriguing given the established connection 253 between RabE proteins and myosin XI-mediated transport (Orr et al., 2021). Previous studies 254 have shown that RabE interacts with myosin XI and functions in polarized secretion, while 255 class XI myosins are required for PEN1 accumulation and pre-invasive immunity to powdery 256 mildew fungi (Yang et al., 2014). The requirement of the barley myosin Required for mlo 257 resistance1 (ROR1) for _mlo_ -mediated immunity further strengthens this connection (Acevedo 258 Garcia et al., 2022). Moreover, RabE interacts with the exocyst complex that mediates secretion [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 259 but also plays an important role in papilla formation (Pecenková et al., 2011; Ortmannová et 260 al., 2022; Pang et al., 2022). Together, these observations support a model in which RabE, 261 myosin XI and exocyst operate within a common trafficking pathway that promotes localized 262 delivery of defence cargo during powdery mildew attack. 263 In contrast, the contribution of RabA to powdery mildew immunity appears largely indirect. 264 Dominant-negative RabA2a rapidly altered the localization of multiple plasma membrane 265 proteins, yet defects in pre-invasive immunity to powdery mildew only became apparent 266 following prolonged induction. RabA therefore appears to function primarily in plasma 267 membrane protein homeostasis, with the eventual defects in this form of immunity arising from 268 progressive disruption of cell surface trafficking rather than from inhibition of a dedicated 269 defence pathway. By contrast, short-term inhibition of RabA, but not RabE, significantly 270 increased penetration by P. infestans, indicating that RabA may play a more direct role in pre 271 invasive immunity against oomycete attack. 272 Our findings fit well with our recent proposal that pre-invasive immunity comprises at least 273 two genetically separable trafficking pathways (Munch et al., 2026). The present work 274 identifies RabE- and RabA-mediated trafficking as key components of these pathways and 275 links their activity to immunity against distinct groups of filamentous pathogens. We propose 276 that RabE acts together with myosin XI and the exocyst to promote focal delivery of defence 277 cargo during powdery mildew attack, whereas RabA predominantly contributes to plasma 278 membrane protein homeostasis while supporting immunity to oomycete invasion. More 279 broadly, these results suggest that pre-invasive immunity does not rely on a single dedicated 280 defence route but instead emerges from the coordinated action of specialized trafficking 281 modules with distinct cargo specificities and pathogen requirements. 282 283 **Figure legends** 284 **Fig. 1: Delayed effects of RabA inhibition on powdery mildew pre-invasive immunity.** 285 Frequency of successful penetrations of leaf epidermal cells by _B. hordei_ in Col-0, 286 _DEX::RabA2a_, _DEX::RabA2a (SN)_ or _DEX::RabA2a (NI)_ sprayed with either control (white 287 bars) or 20 µM dexamethasone (grey bars) 48, 24 and 3 hours before inoculation (A). 288 Frequency of papillae (B) and encasements (C) in response to _B. hordei_ as detected by staining 289 for callose in Col-0 or _DEX::RabA2a (NI)_ treated as in A. Confocal images of callose 290 accumulations in response to _B. hordei_ attack (arrows) in non-penetrated (D,E) and penetrated 291 (F,G) cells (open arrows point to the forming haustorium) in _DEX::RabA2a (NI)_ treated with [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 292 either control (D,F) or 20 µM dexamethasone (E,G). Scale bars = 10 µm. All values are mean 293 ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. 294 295 **Fig. 2: RabA inhibition depletes PEN1 and SYP122 from the plasma membrane.** 296 Representative confocal micrographs of epidermal leaf cells from 7-day-old _DEX::RabA2a_ 297 _(NI)_ seedlings grown on medium containing 20 μM dexamethasone for the indicated periods 298 before imaging. GFP-PEN1 localization following induction of RabA2a (NI) (A). Co 299 localization of RFP-PEN1 and GFP-SYP122 (B-D). Co-localization of RFP-PEN1 and GFP 300 SYP132 (E,F). Expression of RabA2a (NI) progressively altered the localization of PEN1 and 301 SYP122, whereas SYP132 localization remained largely unaffected. Scale bars, 10 μm. 302 303 **Fig. 3: Rapid impairment of pre-invasive immunity following RabE inhibition.** 304 Localization of YFP-RabE1d and mCherry-RabA2a in response to _B. hordei_ attack (arrows) in 305 non-penetrated (A) and penetrated (B) cells (open arrows point to the forming haustorium). 306 Frequency of successful penetrations of leaf epidermal cells by _B. hordei_ in Col-0, 307 _EST::RabA2a (NI)_ or _EST::RabE1d (NI)_ sprayed with either control (white bars) or 20 µM _β_ 308 estradiol (grey bars) 3 hours before inoculation (C). Frequency of successful penetrations of 309 leaf epidermal cells by _B. hordei_ in _glabrous1_ ( _gl1_ ) or _gl1 scd1_ at 25ºC (D). Accumulation of 310 callose in response to _B. hordei_ attack (arrows) in non-penetrated (E,F) and penetrated (G) cells 311 (open arrows point to the forming haustorium) in Col-0, _EST::RabA2a (NI)_ or _EST::RabE1d_ 312 _(NI)_ sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale bars, 10 μm. All values 313 are mean ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. 314 315 **Fig. 4: RabE preferentially affects PEN1 accumulation at papillae.** 316 Papillary accumulation of RFP-PEN1 and GFP-PEN3 in response to _B. hordei_ attack in non 317 penetrated and penetrated cells in Col-0 (A), _EST::RabA2a (NI)_ (B) or _EST::RabE1d (NI)_ (C) 318 sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Quantification of relative papilla 319 to plasma membrane (PM) signal for RFP-PEN1 (D) and PEN3-GFP (E). Scale bars, 10 μm. 320 All values are mean ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n = 15-18. 321 322 **Fig. 5: Differential requirements for RabA and RabE during oomycete invasion.** 323 Frequency of successful penetrations of leaf epidermal cells by _P. infestans_ in Col-0, 324 _EST::RabA2a (NI)_ or _EST::RabE1d (NI)_ sprayed with either control (white bars) or 20 µM _β_ 325 estradiol (grey bars) 3 hours before inoculation (A). Frequency of successful penetrations of [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 326 leaf epidermal cells by _P. infestans_ in _glabrous1_ ( _gl1_ ) or _gl1 scd1_ Scale bars, 10 μm (B). 327 Accumulation of callose in response to _P. infestans_ attack (arrows) in non-penetrated (C,F) and 328 penetrated (D) cells (open arrows point to the forming haustorium) in Col-0, _EST::RabA2a_ 329 _(NI)_ or _EST::RabE1d (NI)_ sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale 330 bars, 10 μm. All values are mean ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n = 331 4-5. 332 333 **Fig. 6: RabE inhibition partially overcomes** _**mlo**_ **-based immunity.** 334 Frequency of successful penetrations of leaf epidermal cells by _G. orontii_ in Col-0, _mlo2 mlo6_ 335 _mlo12, mlo2 mlo6 mlo12_ _EST::RabA2a (NI)_ or _mlo2 mlo6 mlo12_ _EST::RabE1d (NI)_ sprayed 336 with either control (white bars) or 20 µM _β_ -estradiol (grey bars) 3 hours before inoculation 337 (A). Accumulation of callose in response to _G. orontii_ attack (arrows) in non-penetrated (B,C) 338 and penetrated (D,E) cells (open arrows point to the forming haustorium) in Col-0 and _mlo2_ 339 _mlo6 mlo12_ sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale bars, 10 μm. All 340 values are mean ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. 341 342 **Supplementary Fig. 1:** 343 Frequency of successful penetrations of leaf epidermal cells by _B. hordei_ in Col-0, 344 _DEX::RabA2a (SN)_ or _DEX::RabA2a (NI)_ sprayed with either control (white bars) or 20 µM 345 dexamethasone (grey bars) 3 hours before inoculation (A). Frequency of papillae (B) in 346 response to _B. hordei_ as detected by staining for callose in in Col-0, _DEX::RabA2a_, 347 _DEX::RabA2a (SN)_ or _DEX::RabA2a (NI)_ treated as in A. All values are mean ±SD. _P_ < 0.05, 348 one-way ANOVA and Tukey HSD test, n = 4-5. 349 350 **Supplementary Fig. 2:** 351 Representative confocal micrographs of epidermal leaf cells from 7-day-old _DEX::RabA2a_ 352 _(NI)_ seedlings grown on medium containing 20 μM dexamethasone for the indicated periods 353 before imaging. Localization of RFP-PEN1 and the tonoplast marker YFP-VAM711 following 354 induction of RabA2a (NI) (A-C). Localization of GFP-PEN1 and the MVB marker RFP-ARA7 355 (D,E). Localization of RFP-PEN1 and the MVB marker YFP-2xFYVE (F,G). Scale bars, 10 356 μm. 357 358 **Supplementary Fig. 3:** [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 359 Representative confocal micrographs of epidermal leaf cells from 7-day-old _DEX::RabA2a_ 360 _(NI)_ seedlings grown on medium containing 20 μM dexamethasone for the indicated periods 361 before imaging. Localization of RFP-PEN1 and MLO2-YFP (A,B), RFP-PEN1 and TET8 362 GFP (C,D), RFP-PEN1 and PEN3-GFP (E,F) and GFP-PEN1 and secretory marker secRFP 363 (G,H) following induction of RabA2a (NI). Scale bars, 10 μm. 364 365 **Supplementary Fig. 4:** 366 Representative confocal micrographs of root (A) and epidermal leaf cells (B) from plants 367 expressing YFP-RabE1d and mCherry-RabA2a. Scale bars, 10 μm. 7-day-old seedlings of Col 368 0, _EST::RabA2a (NI)_ and _EST::RabE1d (NI)_ grown on media supplemented with 10 µM _β_ 369 estradiol (C). Localization of GFP-PEN1 in Col-0, _EST::RabA2a (NI)_ or _EST::RabE1d (NI)_ 370 sprayed with 20 µM _β_ -estradiol 24 hours before imaging (D). Scale bars, 20 μm. 371 372 **Supplementary Fig. 5:** 373 Accumulation of callose in response to _B. hordei_ attack (arrows) in non-penetrated (A) and 374 penetrated (B) cells (open arrows point to the forming haustorium) in _glabrous1_ ( _gl1_ ) or _gl1_ 375 _scd1_ at 25ºC. Scale bars, 10 μm. 376 377 **Supplementary Fig. 6:** 378 Papillary accumulation of GFP-PEN1 in response to attack by _B. hordei_ (arrows) in Col-0 or 379 _scd1_ at 25ºC (A,B). Frequency of GFP-PEN1 accumulating at _B. hordei_ attack sites in Col-0 380 and _scd1_ at at 25ºC (C). Accumulation of RFP-PEN1 and PEN3-GFP in encasements in 381 response to successful penetration by _B. hordei_ in Col-0, _EST::RabA2a (NI)_ or _EST::RabE1d_ 382 _(NI)_ sprayed with 20 µM _β_ -estradiol 24 hours before imaging (D-E). Scale bars, 10 μm. All 383 values are mean ±SD. _P_ < 0.05, one-way ANOVA and Tukey HSD test, n > 86. 384 385 **Supplementary Fig. 7:** 386 Accumulation of callose in response to _G. orontii_ attack (arrows) in non-penetrated (A,B) and 387 penetrated (C,D) cells (open arrows point to the forming haustorium) in _mlo2 mlo6 mlo12_ with 388 _EST::RabA2a (NI)_ or _EST::RabE1d (NI)_ sprayed with 20 µM _β_ -estradiol 3 hours before 389 inoculation. In _mlo2 mlo6 mo12_ expressing RabA2a (NI) we did not find spores with a fully 390 developed haustorium and secondary hyphal growth. Instead, all penetrated cells had 391 undergone a cell death reaction. In (E,F), accumulation of callose in response to _G. orontii_ [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 392 attack (arrows) in non-penetrated cells in _mlo2 mlo6 mlo12_ or _mlo2 mlo6 mlo12_ _scd1_ at 25ºC. 393 Scale bars, 10 μm. 394 395 **Supplementary Video 1:** 396 Accumulation of callose in response to _P. infestans_ attack in a penetrated cell expressing 397 RabA2a (NI). 398 399 **Supplementary Video 2:** 400 Accumulation of callose in response to _G. orontii_ attack in a penetrated cell in _mlo2 mlo6_ 401 _mlo12_ . 402 403 **Contributions** 404 HMR, DHM, JM and MEN designed the research, performed experimental work, and analyzed 405 the data. The original draft of the manuscript was written by MEN, with writing, review and 406 editing contributions from all other authors. 407 408 **Acknowledgements** 409 The authors would like to thank Mette Sylvan for excellent technical assistance. For generously 410 providing plasmids and seed of mutants and stable transgenic lines we would like to thank 411 Liam Elliot, Gerd Jürgens and Sebastian Y. Bednarek. Imaging data was collected at the Center 412 for Advanced Bioimaging at PLEN. This research was supported by the Novo Nordisk 413 Foundation (NNF19OC0056457 and NNF0086341). 414 415 **Conflict of interest** 416 The authors declare that the research was conducted in the absence of any commercial or 417 financial relationships that could be construed as a potential conflict of interest. 418 419 **Materials and Methods** 420 _Plant and fungal growth_ 421 Plants of _Arabidopsis thaliana_ were grown at 19°C, with 8 h of light at 125 micro Einstein s [−1] 422 m [−2] per day. Plants were grown on plates containing 0.5× MS salts (Murashige and Skoog, 423 Duchefa), with 0.8% (w/v) agar (Type M, Sigma) and moved to soil. For transient induction 424 assays, dexamethasone or _β_ -estradiol was either supplemented in plates (10 µM) or sprayed 425 (20 µM) onto rosette leaves of 4-week-old plants. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 426 All mutant plant lines were reported previously ( _pen1-1_, Collins et al., 2003; _gl1_ and _gl1 scd1-_ 427 _1_, Falbel et al., 2003; _mlo2-5_ _mlo6-2_ _mlo12-1_ and _mlo2-6 mlo6-4 mlo12-8_, Consonni et al., 428 2006;). Transgenic lines expressing dexamethasone inducible RABA2a WT, N125I, S26N or 429 Q71L (Chow et al., 2008) were obtained from the Eurasian Arabidopsis Stock Centre 430 (uNASC). The following transgenic lines were described previously: GFP-PEN1, RFP-PEN1 431 and GFP-SYP122 (Rubiato et al., 2022); GFP-SYP132 (Enami et al., 2009); YFP-VAMP711 432 and YFP-RabE1d (Geldner et al., 2009); RFP-ARA7 (Dettmer et al., 2006); YFP-2xFYVE 433 (Simon et al., 2014); MLO2-YFP (Munch et al., 2026); TET8-GFP (Boavida et al., 2013); 434 PEN3-GFP (Stein et al., 2006); secRFP (Samalova et al., 2006); mCherry-RabA2a (Kirchelle 435 et al., 2016). 436 437 The barley powdery mildew fungus, _Blumeria hordei_ (isolate C15), and the _A. thaliana_ 438 powdery mildew fungus, _Golovinomyces orontii_, were propagated on barley and _A. thaliana_, 439 respectively. _Phytophthora infestans_ strain 88069 (A1 mating type, race 1.3.4.7) was 440 maintained on rye agar plates supplemented with 2% sucrose, 100 mg/L ampicillin, 10 mg/L 441 rifampicin. 442 443 _Generation of transgenic lines expressing estradiol inducible Rab GTPases_ 444 The open reading frame of RabA2a (N125I) was amplified from the DEX::RabA2a (N125) 445 stable line (Chow et al., 2008) and cloned into a Gateway ready pENTR/TOPO-D vector using 446 Multisite Gateway Cloning Technology (Invitrogen). RabE1d (N128I) was generated by a two 447 step PCR reaction from cDNA and cloned into pENTR/TOPO-D vector. RabA2a (N125I) and 448 RabE1d (N128I) were cloned into a modified _β_ -estradiol inducible pMDC7 vector in which 449 Ubiquitin 10 promoter replaced the original promoter (Karnahl et al., 2017). Transgenes 450 _pMDC7::RabA2a (N125)_ and _pMDC7::RabE1d (128I)_ were transformed into GFP-PEN1, 451 RFP-PEN1 or GFP-PEN1 _mlo2-6 mlo6-4 mlo12-8_ and selected for hygromycin resistance 452 (20mg/L) using the floral-dip method (Clough & Bent, 1998). 453 454 _Fluorescent protein and callose detection using confocal microscopy_ 455 Samples were examined using a ×63 water immersion lens mounted on a Leica Stellaris 8 456 confocal microscope. For detection and localization of the fluorophores and stains, green 457 fluorescent protein (GFP) was excited at 488�nm and detected at 500–520�nm. Yellow 458 fluorescent protein (YFP) was excited at 508�nm and detected at 515–575�nm. mCherry was 459 excited at 590 nm and detected at 600–650�nm. Aniline blue-stained callose was excited at [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 460 440�nm and detected at 450–500�nm. Imaging data were collected at the Center for Advanced 461 Bioimaging, University of Copenhagen (Denmark). Projections of serial confocal sections, 462 image overlays, and contrast enhancement were performed using the image processing 463 software (GIMP 2). 464 465 _Infection studies_ 466 Spores from _B. hordei_ and _G. orontii_ were blown evenly onto the leaves of 4- to 5-week-old _A._ 467 _thaliana_ plants and kept at 19°C. Zoospores of _P. infestans_ were released from sporangia by 468 addition of cold water and incubation at 4°C for 90 min. The zoospore suspension was diluted 469 to 5 × 10 [5] or 1 × 10 [6] spores/mL and added to the abaxial side of attached leaves from 4-week 470 old _A. thaliana_ plants. The leaves were kept in a closed Petri dish on water-soaked filter paper 471 at 19°C. For infections studies on _scd1_ mutants, plants were moved to 25°C immediately after 472 inoculation. 473 474 For scoring penetration success, leaf material was Trypan blue (T6146; Sigma-Aldrich) stained 475 at 24�h post inoculation for _B. hordei_, 48�h post inoculation for _G. orontii_, and 24�h post 476 inoculation for _P. infestans_ . Penetration success was determined by light microscopy based on 477 the presence of a developing haustorium inside epidermal cells. Once the penetration status for 478 a particular event was determined, only then was the callose response investigated. Callose 479 staining was performed using 0.01% Aniline blue (415�049; Sigma-Aldrich) in 1�M glycine 480 (adjusted to pH�9.5 using NaOH) and visualized by UV epifluorescence. Statistics are based on 481 >�50 attack sites per leaf of four to five individual plants. 482 483 _Primers_ 484 RabA2a for CACCATGGCGAGAAGACCGGACG 485 RabA2a rev TCAAGACGATGAGCAACAAGGC 486 RabEd for CACCATGGCGGTTGCGCCG 487 RabEd rev CTAAACGTAACTACAGCAAGC 488 RabEd N128I for ATTGGTTGGTAtaAAAGCTGATATGGATGAAAGCAAA 489 RabEd N128I rev ATATCAGCTTTtaTACCAACCAATATTTTGTTGACAT 490 491 **References** 492 Acevedo-Garcia J, Walden K, Leissing F, Baumgarten K, Drwiega K, Kwaaitaal M, Reinstädler 493 A, Freh M, Dong X, James GV, Baus LC, Mascher M, Stein N, Schneeberger K, Brocke [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 494 Ahmadinejad N, Kollmar M, Schulze-Lefert P, Panstruga R. Barley Ror1 encodes a class XI 495 myosin required for mlo-based broad-spectrum resistance to the fungal powdery mildew 496 pathogen. Plant J. 2022 Oct;112(1):84-103. doi: 10.1111/tpj.15930. Epub 2022 Aug 31. PMID: 497 35916711. 498 Assaad FF, Qiu JL, Youngs H, Ehrhardt D, Zimmerli L, Kalde M, Wanner G, Peck SC, Edwards 499 H, Ramonell K, Somerville CR, Thordal-Christensen H. The PEN1 syntaxin defines a novel 500 cellular compartment upon fungal attack and is required for the timely assembly of papillae. 501 Mol Biol Cell. 2004 Nov;15(11):5118-29. doi: 10.1091/mbc.e04-02-0140. Epub 2004 Sep 1. 502 PMID: 15342780; PMCID: PMC524786. 503 Boavida LC, Qin P, Broz M, Becker JD, McCormick S. Arabidopsis tetraspanins are confined 504 to discrete expression domains and cell types in reproductive tissues and form homo- and 505 heterodimers when expressed in yeast. Plant Physiol. 2013 Oct;163(2):696-712. doi: 506 10.1104/pp.113.216598. Epub 2013 Aug 14. PMID: 23946353; PMCID: PMC3793051. 507 Brumm S, Singh MK, Nielsen ME, Richter S, Beckmann H, Stierhof YD, Fischer AM, 508 Kumaran M, Sundaresan V, Jürgens G. Coordinated Activation of ARF1 GTPases by ARF 509 GEF GNOM Dimers Is Essential for Vesicle Trafficking in Arabidopsis. Plant Cell. 2020 510 Aug;32(8):2491-2507. doi: 10.1105/tpc.20.00240. Epub 2020 Jun 2. PMID: 32487565; 511 PMCID: PMC7401013. 512 Chow CM, Neto H, Foucart C, Moore I. Rab-A2 and Rab-A3 GTPases define a trans-golgi 513 endosomal membrane domain in Arabidopsis that contributes substantially to the cell plate. 514 Plant Cell. 2008 Jan;20(1):101-23. doi: 10.1105/tpc.107.052001. Epub 2008 Jan 31. PMID: 515 18239134; PMCID: PMC2254926. 516 Clough SJ, Bent AF. Floral dip: a simplified method for Agrobacterium-mediated 517 transformation of Arabidopsis thaliana. Plant J. 1998 Dec;16(6):735-43. doi: 10.1046/j.1365 518 313x.1998.00343.x. PMID: 10069079. 519 Collins NC, Thordal-Christensen H, Lipka V, Bau S, Kombrink E, Qiu JL, Hückelhoven R, 520 Stein M, Freialdenhoven A, Somerville SC, Schulze-Lefert P. SNARE-protein-mediated 521 disease resistance at the plant cell wall. Nature. 2003 Oct 30;425(6961):973-7. doi: 522 10.1038/nature02076. PMID: 14586469. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 523 Dettmer J, Hong-Hermesdorf A, Stierhof YD, Schumacher K. Vacuolar H+-ATPase activity is 524 required for endocytic and secretory trafficking in Arabidopsis. Plant Cell. 2006 525 Mar;18(3):715-30. doi: 10.1105/tpc.105.037978. Epub 2006 Feb 3. PMID: 16461582; PMCID: 526 PMC1383645. 527 Enami K, Ichikawa M, Uemura T, Kutsuna N, Hasezawa S, Nakagawa T, Nakano A, Sato MH. 528 Differential expression control and polarized distribution of plasma membrane-resident SYP1 529 SNAREs in Arabidopsis thaliana. Plant Cell Physiol. 2009 Feb;50(2):280-9. doi: 530 10.1093/pcp/pcn197. Epub 2008 Dec 19. PMID: 19098073. 531 Falbel TG, Koch LM, Nadeau JA, Segui-Simarro JM, Sack FD, Bednarek SY. SCD1 is required 532 for cytokinesis and polarized cell expansion in Arabidopsis thaliana [corrected]. Development. 533 2003 Sep;130(17):4011-24. doi: 10.1242/dev.00619. Erratum in: Development. 2003 534 Sep;130(18):4495. PMID: 12874123. 535 Geldner N, Dénervaud-Tendon V, Hyman DL, Mayer U, Stierhof YD, Chory J. Rapid, 536 combinatorial analysis of membrane compartments in intact plants with a multicolor marker 537 set. Plant J. 2009 Jul;59(1):169-78. doi: 10.1111/j.1365-313X.2009.03851.x. Epub 2009 Feb 538 26. PMID: 19309456; PMCID: PMC4854200. 539 Hansen LL, Nielsen ME. Plant exosomes: using an unconventional exit to prevent pathogen 540 entry? J Exp Bot. 2017 Dec 18;69(1):59-68. doi: 10.1093/jxb/erx319. PMID: 29036447. 541 Karnahl M, Park M, Mayer U, Hiller U, Jürgens G. ER assembly of SNARE complexes 542 mediating formation of partitioning membrane in _Arabidopsis_ cytokinesis. Elife. 2017 May 543 19;6:e25327. doi: 10.7554/eLife.25327. PMID: 28525316; PMCID: PMC5438246. 544 Kirchhelle C, Chow CM, Foucart C, Neto H, Stierhof YD, Kalde M, Walton C, Fricker M, 545 Smith RS, Jérusalem A, Irani N, Moore I. The Specification of Geometric Edges by a Plant 546 Rab GTPase Is an Essential Cell-Patterning Principle During Organogenesis in Arabidopsis. 547 Dev Cell. 2016 Feb 22;36(4):386-400. doi: 10.1016/j.devcel.2016.01.020. PMID: 26906735; 548 PMCID: PMC4766369. 549 Koch BL, Gardner D, Smith H, Bracewell R, Awdey L, Foster J, Borniego ML, Munch DH, 550 Nielsen ME, Pasupuleti R, Trinidad J, Rutter B, Thordal-Christensen H, Innes RW. Molecular [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 551 insights into the production of extracellular vesicles by plants. Plant Physiol. 2026 Feb 552 6;200(2):kiag011. doi: 10.1093/plphys/kiag011. PMID: 41649923; PMCID: PMC13396842. 553 Li T, Ai G, Fu X, Liu J, Zhu H, Zhai Y, Pan W, Shen D, Jing M, Xia A, Dou D. A Phytophthora 554 capsici RXLR effector manipulates plant immunity by targeting RAB proteins and disturbing 555 the protein trafficking pathway. Mol Plant Pathol. 2022 Dec;23(12):1721-1736. doi: 556 10.1111/mpp.13251. Epub 2022 Oct 3. PMID: 36193624; PMCID: PMC9644280. 557 Munch DH, Rubiato HM, Kwaaitaal M, Reinstädler A, Panstruga R, Nielsen ME. Distinct 558 membrane trafficking pathways defined by the requirement for GNOM or BIG1 to BIG4 559 mediate preinvasive immunity toward filamentous fungal pathogens. New Phytol. 2026 560 Apr;250(1):472-486. doi: 10.1111/nph.70936. Epub 2026 Jan 22. PMID: 41574444. 561 Nielsen ME, Feechan A, Böhlenius H, Ueda T, Thordal-Christensen H. Arabidopsis ARF-GTP 562 exchange factor, GNOM, mediates transport required for innate immunity and focal 563 accumulation of syntaxin PEN1. Proc Natl Acad Sci U S A. 2012 Jul 10;109(28):11443-8. doi: 564 10.1073/pnas.1117596109. Epub 2012 Jun 25. PMID: 22733775; PMCID: PMC3396477. 565 Nielsen ME, Jürgens G, Thordal-Christensen H. VPS9a Activates the Rab5 GTPase ARA7 to 566 Confer Distinct Pre- and Postinvasive Plant Innate Immunity. Plant Cell. 2017 Aug;29(8):1927 567 1937. doi: 10.1105/tpc.16.00859. Epub 2017 Aug 14. PMID: 28808134; PMCID: 568 PMC5590494. 569 Nielsen ME, Thordal-Christensen H. Transcytosis shuts the door for an unwanted guest. Trends 570 Plant Sci. 2013 Nov;18(11):611-6. doi: 10.1016/j.tplants.2013.06.002. Epub 2013 Jul 16. 571 PMID: 23870662. 572 Nielsen E. The Small GTPase Superfamily in Plants: A Conserved Regulatory Module with 573 Novel Functions. Annu Rev Plant Biol. 2020 Apr 29;71:247-272. doi: 10.1146/annurev 574 arplant-112619-025827. PMID: 32442390. 575 Nielsen ME. Vesicle trafficking pathways in defence-related cell wall modifications: papillae 576 and encasements. J Exp Bot. 2024 Jun 24;75(12):3700-3712. doi: 10.1093/jxb/erae155. PMID: 577 38606692. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 578 O'Connell RJ, Panstruga R. Tête à tête inside a plant cell: establishing compatibility between 579 plants and biotrophic fungi and oomycetes. New Phytol. 2006;171(4):699-718. doi: 580 10.1111/j.1469-8137.2006.01829.x. PMID: 16918543. 581 Orr RG, Furt F, Warner EL, Agar EM, Garbarino JM, Cabral SE, Dubuke ML, Butt AM, 582 Munson M, Vidali L. Rab-E and its interaction with myosin XI are essential for polarised cell 583 growth. New Phytol. 2021 Feb;229(4):1924-1936. doi: 10.1111/nph.17023. Epub 2020 Nov 584 28. PMID: 33098085; PMCID: PMC8168425. 585 Ortmannová J, Sekereš J, Kulich I, Šantrůček J, Dobrev P, Žárský V, Pečenková T. Arabidopsis 586 EXO70B2 exocyst subunit contributes to papillae and encasement formation in antifungal 587 defence. J Exp Bot. 2022 Jan 27;73(3):742-755. doi: 10.1093/jxb/erab457. PMID: 34664667. 588 Pandey P, Leary AY, Tumtas Y, Savage Z, Dagvadorj B, Duggan C, Yuen EL, Sanguankiattichai 589 N, Tan E, Khandare V, Connerton AJ, Yunusov T, Madalinski M, Mirkin FG, Schornack S, 590 Dagdas Y, Kamoun S, Bozkurt TO. An oomycete effector subverts host vesicle trafficking to 591 channel starvation-induced autophagy to the pathogen interface. Elife. 2021 Aug 592 23;10:e65285. doi: 10.7554/eLife.65285. PMID: 34424198; PMCID: PMC8382295. 593 Pang L, Ma Z, Zhang X, Huang Y, Li R, Miao Y, Li R. The small GTPase RABA2a recruits 594 SNARE proteins to regulate the secretory pathway in parallel with the exocyst complex in 595 Arabidopsis. Mol Plant. 2022 Mar 7;15(3):398-418. doi: 10.1016/j.molp.2021.11.008. Epub 596 2021 Nov 16. PMID: 34798312. 597 Panstruga R, Moscou MJ. What is the Molecular Basis of Nonhost Resistance? Mol Plant 598 Microbe Interact. 2020 Nov;33(11):1253-1264. doi: 10.1094/MPMI-06-20-0161-CR. Epub 599 2020 Oct 2. PMID: 32808862. 600 Pecenková T, Hála M, Kulich I, Kocourková D, Drdová E, Fendrych M, Toupalová H, Zársky 601 V. The role for the exocyst complex subunits Exo70B2 and Exo70H1 in the plant-pathogen 602 interaction. J Exp Bot. 2011 Mar;62(6):2107-16. doi: 10.1093/jxb/erq402. Epub 2011 Jan 3. 603 PMID: 21199889; PMCID: PMC3060688. 604 Richter S, Kientz M, Brumm S, Nielsen ME, Park M, Gavidia R, Krause C, Voss U, Beckmann 605 H, Mayer U, Stierhof YD, Jürgens G. Delivery of endocytosed proteins to the cell-division [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 606 plane requires change of pathway from recycling to secretion. Elife. 2014 Apr 8;3:e02131. doi: 607 10.7554/eLife.02131. PMID: 24714496; PMCID: PMC3979144. 608 Rubiato HM, Liu M, O'Connell RJ, Nielsen ME. Plant SYP12 syntaxins mediate an 609 evolutionarily conserved general immunity to filamentous pathogens. Elife. 2022 Feb 610 4;11:e73487. doi: 10.7554/eLife.73487. PMID: 35119361; PMCID: PMC8865848. 611 Samalova M, Fricker M, Moore I. Ratiometric fluorescence-imaging assays of plant membrane 612 traffic using polyproteins. Traffic. 2006 Dec;7(12):1701-23. doi: 10.1111/j.1600 613 0854.2006.00502.x. PMID: 17118121. 614 Savary S, Willocquet L, Pethybridge SJ, Esker P, McRoberts N, Nelson A. The global burden 615 of pathogens and pests on major food crops. Nat Ecol Evol. 2019 Mar;3(3):430-439. doi: 616 10.1038/s41559-018-0793-y. Epub 2019 Feb 4. PMID: 30718852. 617 Simon ML, Platre MP, Assil S, van Wijk R, Chen WY, Chory J, Dreux M, Munnik T, Jaillais 618 Y. A multi-colour/multi-affinity marker set to visualize phosphoinositide dynamics in 619 Arabidopsis. Plant J. 2014 Jan;77(2):322-37. doi: 10.1111/tpj.12358. Epub 2013 Dec 6. PMID: 620 24147788; PMCID: PMC3981938. 621 Speth EB, Imboden L, Hauck P, He SY. Subcellular localization and functional analysis of the 622 Arabidopsis GTPase RabE. Plant Physiol. 2009 Apr;149(4):1824-37. doi: 623 10.1104/pp.108.132092. Epub 2009 Feb 20. PMID: 19233904; PMCID: PMC2663744. 624 Stein M, Dittgen J, Sánchez-Rodríguez C, Hou BH, Molina A, Schulze-Lefert P, Lipka V, 625 Somerville S. Arabidopsis PEN3/PDR8, an ATP binding cassette transporter, contributes to 626 nonhost resistance to inappropriate pathogens that enter by direct penetration. Plant Cell. 2006 627 Mar;18(3):731-46. doi: 10.1105/tpc.105.038372. Epub 2006 Feb 10. PMID: 16473969; 628 PMCID: PMC1383646. 629 Stenmark H. Rab GTPases as coordinators of vesicle traffic. Nat Rev Mol Cell Biol. 2009 630 Aug;10(8):513-25. doi: 10.1038/nrm2728. Epub 2009 Jul 15. PMID: 19603039. 631 Tomczynska I, Stumpe M, Mauch F. A conserved RxLR effector interacts with host RABA 632 type GTPases to inhibit vesicle-mediated secretion of antimicrobial proteins. Plant J. 2018 633 Jul;95(2):187-203. doi: 10.1111/tpj.13928. Epub 2018 May 20. PMID: 29671919. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 634 Yang L, Qin L, Liu G, Peremyslov VV, Dolja VV, Wei Y. Myosins XI modulate host cellular 635 responses and penetration resistance to fungal pathogens. Proc Natl Acad Sci U S A. 2014 636 Sep 23;111(38):13996-4001. doi: 10.1073/pnas.1405292111. Epub 2014 Sep 8. PMID: 637 25201952; PMCID: PMC4183272. 638 Yuen ELH, Tumtas Y, King F, Ibrahim T, Chan LI, Evangelisti E, Tulin F, Skłenar J, Menke 639 FLH, Kamoun S, Bubeck D, Schornack S, Bozkurt TO. A pathogen effector co-opts a host 640 RabGAP protein to remodel pathogen interface and subvert defense-related secretion. Sci Adv. 641 2024 Oct 4;10(40):eado9516. doi: 10.1126/sciadv.ado9516. Epub 2024 Oct 4. PMID: 642 39365859; PMCID: PMC11451530. 643 Zheng H, Camacho L, Wee E, Batoko H, Legen J, Leaver CJ, Malhó R, Hussey PJ, Moore I. A 644 Rab-E GTPase mutant acts downstream of the Rab-D subclass in biosynthetic membrane traffic 645 to the plasma membrane in tobacco leaf epidermis. Plant Cell. 2005 Jul;17(7):2020-36. doi: 646 10.1105/tpc.105.031112. Epub 2005 Jun 21. PMID: 15972698; PMCID: PMC1167549. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 1 **A** -/+DEX 48hbi **B** -/+DEX 48hbi **C** -/+DEX 48hbi **c** **a** **a** **a** **a** **a** **c** **100** **a** **a** **a** **100** **80** **60** **40** **20** **0** **80** **60** **40** **20** **0** **80** **60** **40** **20** **0** |Col1|Col2|Col3| |---|---|---| |||| |||| |Col1|Col2| |---|---| ||| |a|Col2| |---|---| ||| ||| ||| **Col-0** **RabA2a** **RabA2a** **(SN)** **RabA2a** **(NI)** **Col-0** **RabA2a** **(NI)** **Col-0** **RabA2a** **(NI)** **RabA2a (NI)** **-DEX** **RabA2a (NI)** **+DEX** **BF** **Callose** **BF** **BF** **Callose** **G** **BF** **Fig. 1: Delayed effects** **of RabA inhibition on powdery mildew pre-invasive immunity.** Frequency of successful penetrations of leaf epidermal cells by B. hordeiin Col-0, DEX::RabA2a, DEX::RabA2a (SN) or DEX::RabA2a (NI) sprayed with either control (white bars) or 20 µM dexamethasone (grey bars) 48, 24 and 3 hours before inoculation (A). Frequency of papillae (B) and encasements (C) in response to B. hordei as detected by staining for callose in Col-0 or DEX::RabA2a (NI) treated as in A. Confocal images of callose accumulations in response to B. hordeiattack (arrows) in non-penetrated (D,E) and penetrated (F,G) cells (open arrows point to the forming haustorium) in DEX::RabA2a (NI) treated with either control (D,F) or 20 µM dexamethasone (E,G). Scale bars = 10 µm. All values are mean ± SD. P < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 2 **B** **RFP-PEN1** **GFP-SYP122** **Merge** **C** **RFP-PEN1** **GFP-SYP122** **Merge** **D** **RFP-PEN1** **GFP-SYP122** **Merge** **E** **RFP-PEN1** **GFP-SYP132** **Merge** **F** **RFP-PEN1** **GFP-SYP132** **Merge** **Fig.** **2:** **RabA** **inhibition** **depletes** **PEN1** **and** **SYP122** **from** **the** **plasma** **membrane.** Representative confocal micrographs of epidermal leaf cells from 7-day-old DEX::RabA2a (NI) seedlings grown on medium containing 20 μM dexamethasone for the indicated periods before imaging. GFP-PEN1 localization following induction of RabA2a (NI) (A). Co-localization of RFP-PEN1 and GFP-SYP122 (B-D). Co-localization of RFP-PEN1 and GFP-SYP132 (E,F). Expression of RabA2a (NI) progressively altered the localization of PEN1 and SYP122, whereas SYP132 localization remained largely unaffected. Scale bars, 10 μm. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 3 **A** **YFP-RabE1d** **mCherry-RabA2a** **Merge** **B** **YFP-RabE1d** **mCherry-RabA2a** **Merge** **C** **60** **50** **40** **30** **20** **10** **0** **50** **40** **30** **20** **10** **0** **D** |Col1|Col2| |---|---| ||| _**gl1 scd1**_ **scd1-1** **Control** **RabA2a (NI)** **RabE1d (NI)** **Col-0** **scd1-1** _**gl1**_ **E** **BF** **F** **BF** **G** **+EST** **+EST** **+EST** **Fig.** **3:** **Rapid** **impairment** **of** **pre-invasive** **immunity** **following** **RabE** **inhibition.** Localization of YFP-RabE1d and mCherry-RabA2a in response to B. hordei attack (arrows) in non-penetrated (A) and penetrated (B) cells (open arrows point to the forming haustorium). Frequency of successful penetrations of leaf epidermal cells by B. hordei in Col-0, EST::RabA2a (NI) or EST::RabE1d(NI) sprayed with either control (white bars) or 20 µM _β_ -estradiol (grey bars) 3 hours before inoculation (C). Frequency of successful penetrations of leaf epidermal cells by B. hordeiin glabrous1 (gl1) or gl1 scd1 at 25ºC (D). Accumulation of callose in response to B. hordei attack (arrows) in non-penetrated (E,F) and penetrated (G) cells (open arrows point to the forming haustorium) in Col-0, EST::RabA2a (NI) or EST::RabE1d(NI) sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale bars, 10 μm. All values are mean ± SD. P< 0.05, oneway ANOVA and Tukey HSD test, n = 4-5. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 4 **RFP-PEN1** **PEN3-GFP** **Merge** **RFP-PEN1** **PEN3-GFP** **Merge** **RFP-PEN1** **PEN3-GFP** **Merge** **D** **E** **8** **a** RFP-PEN1 **8** PEN3-GFP **4** **b** **4** **a** **0** **0** **8** **7** **6** **5** **4** **3** **2** **1** **0** **a** RFP-PEN1 **RabA2a** **RabE1d** **Col-0** **(NI)** **(NI)** **(NI)** **Col-0** **RabA2a** **RabE1d** **Col-0** **RabA2a** **RabE1d** **(NI)** **RabE1d** **Col-0** **RabA2a** **(NI)** **(NI)** **(NI)** **(NI)** **Fig. 4: RabE preferentially affects PEN1 accumulation at papillae.** Papillary accumulation of RFP-PEN1 and GFP-PEN3 in response to B. hordei attack in non-penetrated and penetrated cells in Col-0 (A), EST::RabA2a (NI) (B) or EST::RabE1d (NI) (C) sprayed with 20 µM _β_ estradiol 3 hours before inoculation. Quantification of relative papilla to plasma membrane (PM) signal for RFP-PEN1 (D) and PEN3-GFP (E). Scale bars, 10 μm. All values are mean ± SD. P < 0.05, one-way ANOVA and Tukey HSD test, n = 15-18. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 5 **A** -/+EST 3hbi **80** **60** **40** **b** **B** 25ºC **Col-0** _**gl1**_ _**gl1 scd1**_ **scd1-1** **80** **60** **40** **20** **0** **20** **0** **Col-0** **RabA2a (NI)** **RabE1 (NI** **C** **BF** **D** **BF** **E** **+EST** **+EST** **+EST** **Fig.** **5:** **Differential** **requirements** **for** **RabA** **and** **RabE** **during** **oomycete invasion.** Frequency of successful penetrations of leaf epidermal cells by P. infestans in Col-0, EST::RabA2a (NI) or EST::RabE1d (NI) sprayed with either control (white bars) or 20 µM _β_ -estradiol (grey bars) 3 hours before inoculation (A). Frequency of successful penetrations of leaf epidermal cells by P. infestans in glabrous1(gl1) or gl1scd1Scale bars, 10 μm (B). Accumulation of callose in response to P. infestans attack (arrows) in non-penetrated (C,F) and penetrated (D) cells (open arrows point to the forming haustorium) in Col-0, EST::RabA2a (NI) or EST::RabE1d (NI) sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale bars, 10 μm. All values are mean ± SD. P< 0.05, oneway ANOVA and Tukey HSD test, n = 4-5. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Figure 6 **A** -/+EST 3hbi **B** -/+EST 3hbi **100** **80** **60** **40** **20** **0** **a** **[a]** **Col-0** **mlo3** **-** **RabA2a (NI)** **mlo3/A2a-NI mlo3/E1d-NI** **RabE1d (NI)** _**mlo2 mlo6 mlo12**_ **Callose** **BF** **Callose** **D** **BF** **Callose** **E** **Fig. 6: RabE inhibition partially overcomes mlo-based immunity.** Frequency of successful penetrations of leaf epidermal cells by G. orontii in Col-0, mlo2 mlo6 mlo12, mlo2 mlo6 mlo12 EST::RabA2a (NI) or mlo2mlo6mlo12EST::RabE1d (NI)sprayed with either control (white bars) or 20 µM _β_ -estradiol (grey bars) 3 hours before inoculation (A). Accumulation of callose in response to G. orontii attack (arrows) in nonpenetrated (B,C) and penetrated (D,E) cells (open arrows point to the forming haustorium) in Col-0 and mlo2 mlo6 mlo12 sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. Scale bars, 10 μm. All values are mean ± SD. P < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 1 **A** **80** **60** **40** **20** **0** **Col-0** **RabA2a** **(SN)** **RabA2a** **(NI)** **B** -/+DEX 48hbi **100** **80** **60** **40** **20** **0** **a** **a** **a** **a** **a** **a** **a** |Col1|Col2|Col3| |---|---|---| |||| |||| |||| **Col-0** **RabA2a** **RabA2a** **(SN)** **RabA2a** **(NI)** **Supplementary Fig. 1:** Frequency of successful penetrations of leaf epidermal cells by B. hordei in Col-0, DEX::RabA2a (SN) or DEX::RabA2a (NI) sprayed with either control (white bars) or 20 µM dexamethasone (grey bars) 3 hours before inoculation (A). Frequency of papillae (B) in response to B. hordei as detected by staining for callose in in Col-0, DEX::RabA2a, DEX::RabA2a (SN) or DEX::RabA2a (NI) treated as in A. All values are mean ± SD. P < 0.05, one-way ANOVA and Tukey HSD test, n = 4-5. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 2 **A** **RFP-PEN1** **YFP-VAMP711** **Merge** **B** **RFP-PEN1** **YFP-VAMP711** **Merge** **C** **RFP-PEN1** **YFP-VAMP711** **Merge** **F** **RFP-PEN1** **YFP-2xFYVE** **Merge** **G** **RFP-PEN1** **YFP-2xFYVE** **Merge** **Supplementary Fig. 2:** Representative confocal micrographs of epidermal leaf cells from 7day-old DEX::RabA2a (NI) seedlings grown on medium containing 20 μM dexamethasone for the indicated periods before imaging. Localization of RFP-PEN1 and the tonoplast marker YFP-VAM711 following induction of RabA2a (NI) (A-C). Localization of GFP-PEN1 and the MVB marker RFP-ARA7 (D,E). Localization of RFP-PEN1 and the MVB marker YFP-2xFYVE (F,G). Scale bars, 10 μm. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 3 **A** **RFP-PEN1** **MLO2-YFP** **Merge** **B** **RFP-PEN1** **MLO2-YFP** **Merge** **C** **RFP-PEN1** **TET8-GFP** **Merge** **D** **RFP-PEN1** **TET8-GFP** **Merge** **E** **RFP-PEN1** **PEN3-GFP** **Merge** **F** **RFP-PEN1** **PEN3-GFP** **Merge** **G** **GFP-PEN1** **secRFP** **Merge** **H** **GFP-PEN1** **secRFP** **Merge** **Supplementary Fig. 3:** Representative confocal micrographs of epidermal leaf cells from 7day-old DEX::RabA2a (NI) seedlings grown on medium containing 20 μM dexamethasone for the indicated periods before imaging. Localization of RFP-PEN1 and MLO2-YFP (A,B), RFP-PEN1 and TET8-GFP (C,D), RFP-PEN1 and PEN3-GFP (E,F) and GFP-PEN1 and secretory marker secRFP (G,H) following induction of RabA2a (NI). Scale bars, 10 μm. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 4 **YFP-RabE1d** **mCherry-RabA2a** **Merge** **YFP-RabE1d** **mCherry-RabA2a** **Merge** **D** **GFP-PEN1** **GFP-PEN1** **GFP-PEN1** **Col-0** **RabA2a (NI)** **RabE1d (NI)** **Supplementary Fig. 4:** Representative confocal micrographs of root (A) and epidermal leaf cells (B) from plants expressing YFP-RabE1d and mCherry-RabA2a. Scale bars, 10 μm. 7-day-old seedlings of Col-0, EST::RabA2a (NI) and EST::RabE1d(NI)grown on media supplemented with 10 µM _β_ -estradiol (C). Localization of GFP-PEN1 in Col-0, EST::RabA2a (NI) or EST::RabE1d (NI) sprayed with 20 µM _β_ -estradiol 24 hours before imaging (D). Scale bars, 20 μm. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 5 **Supplementary Fig. 5:** Accumulation of callose in response to B. hordeiattack (arrows) in nonpenetrated (A) and penetrated (B) cells (open arrows point to the forming haustorium) in glabrous1 (gl1) or gl1 scd1 at 25ºC. Scale bars, 10 μm. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 6 **A** **BF** **GFP-PEN1** **C** **a** Col-0 scd1 **Col-0** _**scd1**_ **100** **80** **60** **40** **20** **0** **RFP-PEN1** **PEN3-GFP** **Merge** **RFP-PEN1** **PEN3-GFP** **Merge** **RFP-PEN1** **PEN3-GFP** **Merge** **Supplementary Fig. 6:** Papillary accumulation of GFP-PEN1 in response to attack by B. hordei (arrows) in Col-0 or scd1 at 25ºC (A,B). Frequency of GFP-PEN1 accumulating at B. hordei attack sites in Col-0 and scd1 at at 25ºC (C). Accumulation of RFP-PEN1 and PEN3-GFP in encasements in response to successful penetration by B. hordei in Col-0, EST::RabA2a (NI) or EST::RabE1d (NI) sprayed with 20 µM _β_ -estradiol 24 hours before imaging (D-E). Scale bars, 10 μm. All values are mean ± SD. P < 0.05, one-way ANOVA and Tukey HSD test, n > 86. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.10.765595; this version posted November 12, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.11.10.765595) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # Supplementary Figure 7 **A** **BF** **Callose** **B** **BF** **Callose** **C** **BF** **Callose** **D** **E** **BF** **Callose** **F** **BF** **Callose** **Supplementary Fig. 7:** Accumulation of callose in response to G. orontii attack (arrows) in nonpenetrated (A,B) and penetrated (C,D) cells (open arrows point to the forming haustorium) in mlo2 mlo6 mlo12 with EST::RabA2a (NI) or EST::RabE1d (NI) sprayed with 20 µM _β_ -estradiol 3 hours before inoculation. In mlo2mlo6mo12 expressing RabA2a (NI) we did not find spores with a fully developed haustorium and secondary hyphal growth. Instead, all penetrated cells had undergone a cell death reaction. In (E,F), accumulation of callose in response to G. orontiiattack (arrows) in non-penetrated cells in mlo2 mlo6 mlo12 or mlo2 mlo6 mlo12 scd1 at 25ºC. Scale bars, 10 μm.