# Source paper archive - Source title: The bHLH121-CAT2 module maintains root tip redox homeostasis to confer salt tolerance additively with the SOS pathway in Arabidopsis - Author(s): Zhou, P., Liu, C., Pan, Y., Wang, R., Fei, Y., Liu, B., Du, X., Hossen, M. I., Chen, Y., Liang, L., Shen, R., Lan, P. - Source landing URL: https://www.biorxiv.org/content/10.64898/2026.11.02.763515v1 - PDF URL: https://www.biorxiv.org/content/10.64898/2026.11.02.763515v1.full.pdf - PDF SHA-256: 70a4b055f1841a7d0828c62bd12552791aeb18f326660923384dad5f23ef5b40 - Converter: pymupdf4llm 0.0.27 - Limits: Automated PDF text extraction; reading order, equations, tables and formatting may be incomplete or incorrect. Images are omitted, and no OCR was performed. Markup and links are neutralized for safe downloading. Consult the original PDF for the authoritative version. --- [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) # 1 The bHLH121 – CAT2 module maintains root tip redox homeostasis to 2 confer salt tolerance additively with the SOS pathway in Arabidopsis 3 Peijun Zhou [1,2,3,5], Chuanfa Liu [1,5], Yilin Pan [1,2,3], Ruonan Wang [1] *, Yuchen Fei [1,2,3], 4 Bingyan Liu [1,2,3], Xinran Du [1,2,3], Md. Isrfil Hossen [1,2,3], Yinglong Chen [4], Linzhou 5 Liang [1,3], Renfang Shen [1,2], & Ping Lan [1,2,3] 6 7 1 State Key Laboratory of Soil and Sustainable Agriculture, Institute of Soil Science, 8 Chinese Academy of Sciences, Nanjing 211135, China 9 2 University of Chinese Academy of Sciences, Beijing 100049, China 10 3 University of Chinese Academy of Sciences, Nanjing, 211135, China 11 4 UWA Institute of Agriculture, and School of Agriculture and Environment, The 12 University of Western Australia, Perth, WA 6001, Australia 13 5 These authors contributed equally: Peijun Zhou, Chuanfa Liu 14 15 *Correspondence: plan@issas.ac.cn (Ping Lan), wangruonan@issas.ac.cn (Ruonan 16 Wang). 17 18 19 20 21 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) # 22 Abstract 23 Soil salinity inhibits plant growth, in part, by restricting the availability of essential 24 mineral nutrients such as iron (Fe). Although Fe deficiency frequently coincides with 25 salt stress in the field, the molecular mechanisms integrating Fe homeostasis with salt 26 tolerance remain largely unknown. Here, we identify the Fe deficiency response 27 regulator bHLH121 as a key coordinator of salt tolerance in Arabidopsis. Loss-of 28 function mutants of bHLH121 exhibit pronounced hypersensitivity to salt stress, with 29 severely impaired primary root elongation and reduced seedling biomass. 30 Transcriptomic and histochemical analyses reveal that bHLH121 is required to 31 maintain reactive oxygen species (ROS) homeostasis specifically in root tips under salt 32 stress. We further demonstrate that _CATALASE 2_ ( _CAT2_ ) is a direct downstream target 33 of bHLH121, and that _CAT2_ overexpression fully rescues the salt hypersensitivity of 34 the _bhlh121_ mutant. Importantly, this bHLH121 – CAT2 module operates independently 35 of the classical SOS pathway, as _sos2 bhlh121_ double mutants display additive salt 36 sensitivity. Together, our findings uncover a novel regulatory module in which 37 bHLH121 governs root tip redox homeostasis through CAT2 to confer salt tolerance, 38 providing a direct mechanistic link between the Fe regulatory network and abiotic stress 39 resilience in plants. 40 41 **Keywords:** bHLH121, CAT2, ROS homeostasis, salt stress, _Arabidopsis_ 42 43 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) # 44 1 Introduction 45 Soil salinization is one of the major abiotic constraints limiting crop productivity 46 worldwide. The damage imposed by salt stress on plants is multifaceted, and disruption 47 of cellular ionic homeostasis is particularly critical (Mittler et al., 2022; Yang et al., 48 2018; Zhou et al., 2024). In the model plant _Arabidopsis thaliana_, one of the central 49 mechanisms underlying salt stress responses is the SOS (Salt Overly Sensitive) 50 signaling pathway (Ma et al., 2026). This pathway comprises the calcium sensor SOS3, 51 the protein kinase SOS2, and the plasma membrane Na [+] /H [+] antiporter SOS1. Upon salt 52 stress, cytosolic Ca [2+] signals are perceived by SOS3, which recruits and activates SOS2; 53 the SOS3–SOS2 complex then phosphorylates and activates SOS1, driving Na [+] efflux 54 and maintaining cellular Na [+] /K [+] balance. The discovery of the SOS pathway laid the 55 foundation for understanding the molecular basis of plant salt tolerance, and the 56 functional conservation of its components has been documented in a wide range of crop 57 species. 58 However, the deleterious effects of salt stress are not restricted to ionic imbalance 59 (van Zelm et al., 2020; Yang et al., 2018). A common metabolic consequence is the 60 overaccumulation of reactive oxygen species (ROS), which cause oxidative damage to 61 proteins, DNA, and membrane lipids (Mittler et al., 2022; Yang et al., 2018; Zhou et 62 al., 2024). Under salt stress, stomatal closure restricts CO 2 availability, and 63 photosystems are directly damaged, leading to over-reduction of the photosynthetic 64 electron transport chain. This promotes substantial electron leakage to O 2, generating 65 superoxide anions (O 2 [•−] ) within chloroplasts (Castro et al., 2021; Miller et al., 2010; 66 van Zelm et al., 2020). Parallel disruption of mitochondrial respiration further 67 contributes to O 2 [•−] production via electron leakage under ionic imbalance. Apoplastic 68 ROS generation is simultaneously enhanced through the activation of NADPH oxidases 69 (RBOHs). Critically, this elevated ROS production coincides with a compromised 70 antioxidant system, in which suppression of key enzymes such as catalase (CAT) 71 dampens hydrogen peroxide (H 2 O 2 ) scavenging capacity. Together, these disruptions 72 overwhelm cellular redox homeostasis, leading to oxidative damage and the 73 progression of stress injury. Therefore, the establishment of salt tolerance depends not 74 only on the maintenance of ionic homeostasis but also on the precise control of redox 75 homeostasis. 76 Iron (Fe) occupies a particularly important position within this redox regulatory 77 network. As a cofactor for numerous enzymes involved in photosynthesis, respiration, [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 78 and redox reactions, Fe is essential for plant growth and development (Briat et al., 2015; 79 Li et al., 2022). Consequently, misregulation of Fe metabolism under stress conditions 80 can exacerbate ROS production and lead to oxidative damage (Gupta et al., 2024; 81 Hansch et al., 2009). In saline soils, high pH and competitive effects of Na [+] often impair 82 Fe acquisition, creating a combined “salt stress–Fe deficiency” scenario. Notably, 83 multiple lines of evidence demonstrate that Fe deficiency-responsive genes can 84 simultaneously influence Fe nutrition and salt tolerance. The Fe deficiency- responsive 85 gene _Femu2_ was reported to be induced by both iron deficiency and salt stress in 86 _Chlamydomonas reinhardtii_ ; its overexpression significantly enhanced salt tolerance, 87 whereas silencing increased salt sensitivity, accompanied by decreased proline and 88 soluble sugar contents and elevated MDA levels (Li et al., 2017). The apple bHLH 89 transcription factor MxbHLH18 was shown to be induced by both salt and Fe stresses, 90 and its overexpression in _Arabidopsis_ enhanced tolerance to salt, high Fe, and low Fe, 91 with increased SOD, POD, and CAT activities, reduced MDA, H 2 O 2, and O 2 [•−] contents, 92 and upregulated expression of both salt-responsive and iron-responsive genes (Liang et 93 al., 2022). Most recently, the soybean ferritin gene _GmFER1_ was demonstrated to 94 enhance salt tolerance through a coordinated “Fe–antioxidant–ion homeostasis” 95 regulatory network: overexpression of _GmFER1_ promoted Fe [3+] accumulation, 96 enhanced SOD and CAT activities, and upregulated _GmSOS1_ -mediated Na [+] efflux, 97 while simultaneously improving yield through enhanced photosynthetic efficiency and 98 Rubisco activity (Zhang et al., 2025). Collectively, these findings demonstrate that Fe 99 homeostasis components can coordinately regulate both Fe nutrition and salt tolerance 100 across diverse plant species, suggesting an intrinsic link between the Fe homeostasis 101 regulatory network and salt stress responses. However, the molecular mechanism by 102 which the Fe regulatory machinery participates in the maintenance of redox 103 homeostasis under salt stress remains largely unclear. 104 In _Arabidopsis_, the core transcriptional network governing Fe homeostasis is 105 orchestrated by basic helix-loop-helix (bHLH) transcription factors (Gao et al., 2024). 106 FIT, the master regulator of Fe acquisition, forms heterodimers with subgroup Ib bHLH 107 proteins including bHLH38/39/100/101 to orchestrate the Fe deficiency response 108 (Colangelo et al., 2004). This module is positively regulated by upstream subgroup IVc 109 bHLH factors, including bHLH34, bHLH104, ILR3/bHLH105, and bHLH115 (Li et al., 110 2016; Liang et al., 2017; Wang et al., 2013; Yuan et al., 2008; Zhang et al., 2015). 111 Notably, the Upstream Regulator of IRT1 (URI)/bHLH121 emerges as a central, 112 bridging factor that physically interacts with bHLH IVc proteins and facilitates the [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 113 expression of _FIT_ and _bHLH38/39/100/101_ by bHLH IVc transcription factors (Gao et 114 al., 2024; Gao et al., 2020; Kim et al., 2019; Lei et al., 2020). This regulatory circuit is 115 negatively controlled by E3 ubiquitin ligases; BTS targets bHLH IVc factors for 116 degradation (Selote et al., 2015), while BTSL1 and BTSL2 mediate FIT turnover 117 (Rodríguez-Celma et al., 2019). 118 The choice of bHLH121 as a focal point of this study was based on several lines of 119 evidence. First, bHLH121 occupies a central position in the Fe regulatory network, 120 serving as a key node connecting upstream signals to downstream responses. Second, 121 in peanut ( _Arachis hypogaea_ ), _AhbHLH121_ overexpression enhances antioxidant 122 enzyme activity and salt tolerance (Zhao et al., 2024). Similarly, bHLH121 was 123 identified as a transcription factor regulating the high-affinity K [+] transporter HAK5, 124 with its expression induced by both low K [+] and salt stress (Hong et al., 2013). Moreover, 125 bHLH121 (URI) acts as an essential component of the Fe deficiency signaling pathway 126 (Kim et al., 2019). Through re-analysis of the ChIP-seq data from Kim et al. (2019), we 127 found that the direct binding targets of bHLH121 include ROS-related genes, 128 suggesting a potential link between bHLH121 and redox regulation. Overall, these 129 findings suggest that bHLH121 may act as a critical hub coordinating Fe homeostasis 130 and salt stress responses. However, the function of bHLH121 in _Arabidopsis_ salt stress 131 responses has not been reported, and whether and how it contributes to salt tolerance 132 through the regulation of redox homeostasis remains to be elucidated. 133 To address this, we assessed the expression profile of _bHLH121_ and confirmed its 134 salt responsiveness. Consistently, _bhlh121_ loss-of-function mutants displayed 135 hypersensitivity, with substantially reduced root elongation and lower seedling fresh 136 weight. Transcriptome profiling revealed that _bHLH121_ is required for the proper 137 expression of a suite of genes involved in redox homeostasis, and ROS staining 138 combined with pharmacological assays confirmed that bHLH121 regulates redox 139 homeostasis, specifically within root tips. Notably, overexpression of _CAT2_, a 140 representative H 2 O 2 -scavenging gene, rescued the salt hypersensitivity of the _bhlh121_ 141 loss-of-function mutant, and bHLH121 was shown to bind the _CAT2_ promoter. 142 Collectively, these findings establish the bHLH121–CAT2 module as a crucial 143 regulator of redox homeostasis in plant resilience to salt stress. # 144 2 Materials and methods 145 **2.1 Plant materials and growth conditions** [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 146 _Arabidopsis thaliana_ ecotype Columbia-0 (Col-0) plants were used as the wild-type 147 (WT). The _sos2-T1_ mutant was described previously (Ma et al., 2025). The _bhlh121-7_ 148 and _bhlh121-8_ mutants, the _pro35S::bHLH121:GFP/WT_ overexpression lines, and the 149 complemented lines including _probHLH121::gbHLH121:GFP/bhlh121-7,_ 150 _pro35S::PtbHLH121:GFP/bhlh121-7,_ _pro35S::GsbHLH121:GFP/bhlh121-7,_ 151 _pro35S::CcbHLH121:GFP/bhlh121-7,_ and _pro35S::CsbHLH121:GFP/bhlh121-7_ ) 152 were generated as described (Zhou et al., 2026). The _sos2-T1_ and _bhlh121-7_ mutants 153 were crossed to generate the _sos2 bhlh121_ double mutant. 154 _Arabidopsis_ seeds were sterilized by washing first with 75% ethanol for 3 min, 155 followed by 0.5% (v/v) NaClO solution containing 0.5% (v/v) Tween 20 for 10 min, 156 and finally rinsing five times with sterile deionized water. After stratification at 4 °C 157 for 2 d, sterilized seeds were sown on ES medium (Estelle et al., 1987) and grown in a 158 greenhouse under a 22 °C under a 16-h light ( _c._ 100 μmol·m [-2] - s [-1 ] over the waveband 159 400–700 nm) /8-h dark photoperiod at 20 °C. 160 The ES medium contained 5 mM KNO 3, 2 mM Ca(NO 3 ) 2 - 4H 2 O, 2 mM 161 MgSO 4 - 7H 2 O, 2.5 mM KH 2 PO 4, 40 μM Fe(III)-EDTA, 14 μM MnCl 2 - 4H 2 O, 70 μM 162 H 3 BO 3, 1 μM ZnSO 4 - 7H 2 O, 0.5 μM CuSO 4 - 5H 2 O, 0.2 μM NaMoO 4 - 2H 2 O, and 10 μM 163 NaCl, and was used as the control treatment. For salt stress treatments, NaCl was added 164 at 75, 100, or 150 mM. For pharmacological treatments, diethyldithiocarbamic acid 165 (DIECA) at 25, 50, and 100 μM was used to inhibit jasmonic acid (JA) biosynthesis, 166 while indole-3-acetic acid (IAA) at 10, 50, and 100 nM was applied to simulate auxin 167 effects. Additionally, 500 μM potassium iodide (KI) and 200 μM glutathione (GSH) 168 were supplemented as ROS scavengers to alleviate oxidative stress. All media 169 contained 1% sucrose (w/v), 0.1% MES (w/v), and 0.8% agar (w/v), with the pH 170 adjusted to 5.5. 171 **2.2 Plasmid construction and generation of transgenic plants** 172 The full-length coding sequence of _CAT2_ was amplified by PCR and cloned into the 173 modified binary vector _pCAMBIA1300-GFP_, driven by the cauliflower mosaic virus 174 (CaMV) 35S promoter. The resulting recombinant plasmid _pro35S::CAT2:GFP_ was 175 transformed into _Agrobacterium_ strain GV3101. Subsequently, _Arabidopsis_ plants 176 were transformed using the floral dip method. T0 transgenic seeds were screened on 177 half-strength Murashige & Skoog medium containing 25 mg L **[–]** [1] hygromycin. Three 178 independent stable lines were selected for further analyses. Primers are listed in 179 Supplementary Table S1. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 180 **2.3 Root length and fresh weight analyses** 181 For the root elongation and fresh weight assays, _Arabidopsis_ seeds were germinated 182 and grown vertically on ES medium with or without NaCl supplementation. After 10 d 183 of cultivation in a greenhouse, seedlings were photographed to document their 184 phenotypes. Primary root lengths were quantified from at least 20 seedlings per 185 biological replicate using ImageJ software (National Institutes of Health, USA). Fresh 186 weight was determined from pools of 10 seedlings. All experiments included three 187 biological replicates, and representative data from one replicate are shown in the figures. 188 **2.4 Measurement of chlorophyll content** 189 Chlorophyll was extracted from _Arabidopsis_ shoots with 80% acetone in the dark until 190 tissues were fully bleached. The absorbance of the supernatant was read at 645 and 663 191 nm on a SpectraMax Plus 384 spectrophotometer (Molecular Devices). Total 192 chlorophyll was quantified as (20.2 × A645 + 8.02 × A663) × V/FW and expressed in 193 mg·g [-1] FW, as described previously (Arnon, 1949). 194 **2.5 Proline and malondialdehyde (MDA) assays** 195 Measurements were performed as described (Hodges et al., 1999), with minor 196 modifications. Briefly, seeds were sown on medium with or without 75 mM NaCl and 197 grown for 10 d, after which shoot and root tissues were harvested separately. Crude 198 protein extracts were prepared using 100 mM PBS (pH 7.8). 199 For proline determination, 150 µL of crude protein extract was mixed with 1 mL of 200 reaction solution containing 0.75% (w/v) sulfosalicylic acid, 25% (v/v) glacial acetic 201 acid, and 1.25% (w/v) acid ninhydrin, prepared in 100 mM PBS (pH 7.0). The mixture 202 was incubated in a boiling water bath for 15 min, and absorbance was measured at 520 203 nm using a spectrophotometer. Proline content was calculated based on a proline 204 standard curve. 205 For MDA measurement, 100 µL of crude protein extract was added to 1 mL of 0.25% 206 thiobarbituric acid solution prepared in 10% trichloroacetic acid. After boiling for 15 207 min, absorbance was measured at 532 nm and 600 nm. MDA content was calculated 208 using the formula: MDA (nmol·g **[–]** [1] FW) = (A532-A600) × Vr × (V/Vt)/155 × 1000/ 209 FW, where Vr is the total volume of the reaction mixture, V is the total volume of the 210 protein extract, Vt is the volume of protein extract used in the assay, and FW is the 211 sample fresh weight. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 212 **2.6 Electrolyte leakage assay** 213 The electrolyte leakage (EL) assay was performed as described previously (Panter et 214 al., 2019) with modifications. Nine-day-old seedlings grown on ES medium were 215 transferred to fresh medium with or without 100 mM NaCl and grown for an additional 216 5 d. Shoots and roots were harvested separately for analysis. Briefly, 0.1 g of fresh 217 tissue was placed in a tube containing 5 mL of ultrapure water and shaken at room 218 temperature for 3 h. Initial conductivity (C1) was measured using a conductivity meter. 219 Samples were then boiled for 20 min, cooled to room temperature, and final 220 conductivity (C2) was measured. Relative electrolyte leakage was calculated as (C1/C2) 221 × 100%. 222 **2.7 Determination of Na** **[+]** **and K** **[+]** **content** 223 Nine-day-old seedlings grown on ES medium were transferred to medium 224 supplemented with 100 mM NaCl and treated for 5 d. Shoot and root tissues were then 225 harvested separately and dried in an oven at 65 °C. The dried tissues were digested with 226 concentrated nitric acid at 150 °C. Na [+] and K [+] contents were determined using a flame 227 photometer (FP6431, YOKE) as described previously (Karimi et al., 2021). 228 **2.8 Measurement of H** **2** **O** **2** **content and antioxidant enzyme activities** 229 The activities of catalase (CAT), peroxidase (POD) and superoxide dismutase (SOD), 230 as well as the content of hydrogen peroxide (H 2 O 2 ), were measured using commercially 231 available kits (Geruisi ‐ bio, G0105W, G0107W, G0101W, and G0168W, respectively). 232 Seven-day-old seedlings grown on ES medium were transferred to fresh medium with 233 or without 100 mM NaCl and grown for an additional 7 d. Roots were harvested for 234 analysis. 235 **2.9 Quantitative real-time PCR (RT-qPCR) analysis** 236 TRIzol reagent (Vazyme) was employed for total RNA extraction in accordance with 237 the manufacturer’s recommendations. Reverse transcription of 1 µg of RNA into cDNA 238 was carried out using the PrimeScript™ RT reagent Kit with gDNA Eraser (TaKaRa). 239 Following a 12-fold dilution, the cDNA products were used as templates for RT‑qPCR 240 on a PIKOREAL 96 platform (Thermo Fisher Scientific) with the SYBR® Premix Ex 241 Taq™ II (Tli RNaseH Plus) kit (TaKaRa). The amplification procedure was initiated at 242 95°C for 7 min, then cycled 40 times at 95 °C for 5 s and 60 °C for 30 s. The _TUA3_ 243 gene (At5g19770) served as the normalization standard, and relative transcript [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 244 abundances were calculated via the 2 [−ΔΔCT] method. Primers used are listed in 245 Supplementary Table S1. 246 **2.10 Messenger RNA (mRNA)-seq and transcriptome analyses** 247 Seedlings were grown on ES medium with or without 100 mM NaCl. Total RNA was 248 extracted from the roots of 10-day-old seedlings. mRNA-seq was performed by 249 Novogene Bioinformatics Technology Co., Ltd. (Beijing, China) and sequenced on a 250 NovaSeq 6000 platform (Illumina) to generate 150-bp paired-end reads. Data analysis 251 was performed as described previously with minor modifications (Xue et al., 2021). 252 Briefly, clean data were obtained by removing reads containing adapters, reads with a 253 high proportion of uncertain bases (≥10%) and low-quality reads from the raw data. 254 The clean reads were then mapped to the _Arabidopsis_ Araport11 reference genome 255 (Cheng et al., 2017) using HISAT2, and differentially expressed genes (DEGs) were 256 identified using Cufflinks. Significantly up- and down-regulated DEGs were filtered by 257 fold change > 1.5 and q value < 0.05. Gene Ontology (GO) enrichment analyses and 258 heatmaps of gene expression profiles were generated using the OmicShare tools 259 platform (http://www.omicshare.com/tools). 260 **2.11 DAB and NBT staining** 261 Diaminobenzidine (DAB) and nitroblue tetrazolium (NBT) were used for in situ 262 staining of hydrogen peroxide (H 2 O 2 ) and superoxide anions (O 2 [•] **[−]** ) in seedlings, 263 respectively (Dai et al., 2022). Seedlings were incubated in DAB staining solution (1 264 mg·mL [−1], pH 5.8) or NBT staining solution (0.5 mg·mL [−1], pH 7.6) for 60 min or 30 265 min, respectively, followed by the removal of the staining solution and three rinses with 266 deionized water. Then, 1 mL of anhydrous ethanol was added for decolorization. After 267 decolorization was complete, seedlings were observed and photographed under a Zeiss 268 Stemi 305 microscope. DAB and NBT intensities were acquired in ImageJ using the 269 segmented line tool, with line thickness sufficient to cover half the width of the root. 270 Staining was quantified based on the gray values of linear ROIs. 271 **2.12 Measurement of root apical meristem size** 272 The root apical meristem was determined as previously described (Dello Ioio et al., 273 2007). In brief, seedlings were grown vertically on the indicated medium, and roots of 274 10-day-old seedlings were imaged using a confocal laser scanning microscope 275 (STELLARIS 5, Leica). Before imaging, roots were stained with propidium iodide (PI) 276 for 10 min. PI fluorescence was detected using excitation with an argon laser at 488 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 277 nm, with an emission filter set between 633 and 695 nm. Cortex cells were counted 278 from the QC to the first elongated cell to determine meristem cell number and length. 279 **2.13 Electrophoretic mobility shift assay (EMSA)** 280 EMSA was carried out using the Chemiluminescent EMSA Kit (Beyotime, China) 281 according to the manufacturer’s protocol. The recombinant bHLH121 protein was 282 expressed in _E. coli_ and purified as described previously (Zhou et al., 2026). The DNA 283 fragments of the _CAT2_ promoter were synthesized and labeled with biotin at their 5′ 284 ends. Unlabeled probes, either identical or mutated in sequence, were included as 285 specific competitors, and a 6xHis-tagged trigger factor (His-TF) protein preparation 286 from _E. coli_ transformed with the empty vector was used as the negative control. Probes 287 used in these assays are listed in Supplementary Table S1. 288 **2.14 Statistical analysis** 289 All data are presented as means ± standard deviation (SD). Statistical analyses and 290 graph generation were performed using GraphPad Prism 9.5. Differences between two 291 groups were assessed using Student’s t-test, with asterisks indicating significance (* _P_ 292 < 0.05, ** _P_ < 0.01, *** _P_ < 0.001, **** _P_ < 0.0001). For multiple comparisons, one 293 way ANOVA followed by Tukey’s post hoc test was performed, with different letters 294 indicating significant differences ( _P_ < 0.05). Each experiment included at least three 295 independent biological replicates. 296 **2.15 Accession numbers** 297 Sequence data from this article can be found in the Arabidopsis Genome Initiative or 298 GenBank/EMBL databases under the following accession numbers: bHLH121 299 (AT3G19860), SOS1 (AT2G01980), SOS2 (AT5G35410), IRT1 (AT4G19690), FRO2 300 (AT1G01580), PLT1 (AT3G20840), PLT2 (AT1G51190), RBOHD (AT5G47910), 301 PRX8 (AT1G34510), CAT2 (AT4G35090), JAZ1 (AT1G19180), JAZ10 302 (AT5G13220), GH3.15 (AT5G13370), TUA3 (AT5G19770), PtbHLH121 303 (Potri.004G168100), GsbHLH121 (XP_028243911), CcbHLH121 (ESR36836), and 304 CsbHLH121 (KGN61896). [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) # 305 3 Results 306 **3.1 Loss of function** _**bhlh121**_ **mutations lead to salt hypersensitivity in** 307 _**Arabidopsis**_ 308 To investigate whether _bHLH121_ is involved in plant salt stress tolerance, we first 309 analyzed its expression in response to NaCl treatment. These analyses identified 310 bHLH121 as a candidate salt-responsive gene, as its expression was significantly 311 induced by salt stress in a dose- and time-dependent manner (Supplementary Fig. S1). 312 We previously generated two CRISPR-Cas9-mediated knockout mutants in the WT 313 background, designated _bhlh121-7_ and _bhlh121-8_ ; these mutants exhibit severe growth 314 defects and impaired Fe deficiency-responsive gene expression under Fe depletion 315 (Zhou et al., 2026). To dissect the functional role of bHLH121 in salt tolerance, we 316 germinated these two mutants and examined their growth phenotypes at 75, 100, and 317 150 mM NaCl. Both mutants displayed salt hypersensitivity, as evidenced by 318 significantly reduced root elongation (Supplementary Fig. S2). Because both mutants 319 exhibited similar salt-sensitive phenotypes, we selected _bhlh121-7_ as a representative 320 mutant for subsequent analyses. 321 A native promoter-driven bHLH121-GFP fusion protein successfully restored root 322 growth and biomass in the _bhlh121-7_ mutant under salt stress (Supplementary Fig. S3), 323 validating the functionality of bHLH121-GFP and confirming that _bHLH121_ loss is 324 causal for the salt-sensitive phenotype. Intriguingly, although the loss-of-function 325 _bhlh121-7_ mutant displayed pronounced salt sensitivity, 35S promoter-driven 326 overexpression of _bHLH121_ in WT plants failed to enhance salt tolerance, as no 327 significant differences in root growth or biomass were observed compared to WT (Fig. 328 1A–C). These results support the notion that _bHLH121_ function is indispensable for 329 salt stress tolerance in _Arabidopsis_ . 330 To explore the physiological mechanisms underlying _bhlh121_ -associated salt 331 sensitivity, we first quantified proline accumulation, a stress tolerance indicator (Dai et 332 al., 2018), in salt-stressed seedlings. Although proline content increased in both WT [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 333 and _bhlh121-7_ mutant, shoot and root proline levels in _bhlh121-7_ were significantly 334 lower than in WT under salt stress (Fig. 1D, E), pointing to a potential mechanism 335 responsible for the mutant’s sensitive phenotype. To assess whether _bHLH121_ 336 contributes to antioxidant defense against salts, we measured the malondialdehyde 337 (MDA) content and electrolyte leakage (EL), indicators of oxidative damage (Liu et al., 338 2021b). MDA induction by NaCl was more pronounced in roots than shoots in both 339 WT and _bhlh121-7_ ; nevertheless, MDA levels were significantly higher in _bhlh121-7_ 340 than WT in both tissues (Fig. 1 F, G). Consistently, EL was triggered by salt stress, with 341 shoot EL higher in _bhlh121-7_ than WT under both control and NaCl treatments (Fig. 342 1H, I). 343 As ion homeostasis is a major determinant of salt tolerance (Motte et al., 2019; van 344 Zelm et al., 2020) and bHLH121 is crucial for regulating metal ion transporters (Gao et 345 al., 2020; Kim et al., 2019; Lei et al., 2020), we analyzed Na [+] and K [+] concentrations 346 and Na [+] /K [+ ] ratios in salt-stressed seedlings. In control groups, no obvious differences 347 in basal Na [+] and K [+] levels were observed under standard growth conditions in either 348 shoots or roots. By contrast, salt treatment dramatically elevated Na [+] levels and reduced 349 K [+] levels in all samples (Fig. 1J–M). Compared with WT, Na [+ ] accumulation and K [+ ] 350 reduction were more pronounced in shoots, whereas no significant changes were 351 observed in roots. Consequently, Na [+] /K [+ ] ratios in shoots, but not in roots, were slightly 352 increased in _bhlh121-7_ (Fig. 1N, O). 353 Collectively, these findings demonstrate that the salt stress sensitivity of _bhlh121-7_ 354 roots is due to impaired proline induction and increased MDA contents, whereas 355 significantly increased EL and disrupted Na⁺/K⁺ homeostasis were detected in shoots. 356 Therefore, the _bhlh121-7_ mutation appears to impair the plant antioxidant response, 357 especially in roots. 358 **3.2 bHLH121 and SOS2 function in parallel pathways in salt tolerance** 359 Although bHLH121 is a key transcription factor regulating Fe homeostasis, its role in 360 plant salt tolerance has not been previously reported in _Arabidopsis_ . To investigate the [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 361 underlying mechanism, we examined the genetic relationship between the bHLH121 362 mediated salt tolerance pathway and the classical SOS pathway by generating a 363 _bhlh121-7 sos2-T1_ double mutant through genetic crossing. Under normal growth 364 conditions, the _bhlh121-7_ and _sos2-T1_ single mutants and the _bhlh121-7 sos2-T1_ 365 double mutant showed no obvious growth defects (Fig. 2A). By contrast, when grown 366 on ES medium supplemented with NaCl at a concentration as low as 25 mM, the _sos2-_ 367 _T1_ single mutant displayed a pronounced salt-sensitive phenotype, characterized by 368 significant inhibition of primary root elongation (Fig. 2A), consistent with previous 369 reports (Ma et al., 2025). The _bhlh121-7_ single mutant was less salt-sensitive than _sos2-_ 370 _T1_ (Fig. 2A). Importantly, the primary root length of the _bhlh121-7 sos2-T1_ double 371 mutant was significantly shorter than that of WT and was also substantially shorter than 372 that of either single mutant (Fig. 2A, B). Consistently, the fresh weight and chlorophyll 373 content of the double mutant were lower than those of the two single mutants (Fig. 2C, 374 D). This additive effect suggests that bHLH121 and SOS2 may act in parallel genetic 375 pathways to modulate salt stress responses. To further test this hypothesis, we examined 376 _SOS1_ expression, a key downstream gene in the SOS pathway, under salt stress. NaCl 377 treatment induced significantly higher _SOS1_ expression in the _bhlh121-7 sos2-T1_ 378 double mutant than in WT plants. In contrast, _SOS1_ induction in the _bhlh121-7_ and 379 _sos2-T1_ single mutants was comparable to that in WT (Fig. 2E). These results suggest 380 that the enhanced salt sensitivity of the double mutant is accompanied by altered _SOS1_ 381 regulation, consistent with bHLH121 and SOS2 acting in parallel pathways. 382 We also examined the phenotypes of the _bhlh121-7 sos2-T1_ double mutant grown on 383 low-Fe (0 μM Fe) medium. Introduction of the _sos2-T1_ mutation into the _bhlh121-7_ 384 mutant did not cause obvious growth defects (Fig. 2A). Measurements of root length, 385 fresh weight, and chlorophyll content consistently showed that the _bhlh121-7 sos2-T1_ 386 double mutant grew as well as the _bhlh121-7_ single mutant (Fig. 2B–D). Notably, _IRT1_ 387 and _FRO2_, two marker genes for the Fe deficiency response, showed slightly reduced 388 expression in the double mutant compared with the _bhlh121-7_ single mutant (Fig. 2F, [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 389 G). These data suggest that bHLH121 and SOS2 do not have substantially overlapping 390 roles in the Fe deficiency response. 391 Taken together, these results suggest that loss of _bHLH121_ does not obviously impair 392 SOS pathway-mediated signaling output, consistent with the possibility that bHLH121 393 functions independently of the SOS pathway to confer salt tolerance. 394 **3.3 bHLH121 is crucial for ROS homeostasis and root growth under salt stress** 395 To determine whether ROS accumulation increased abnormally due to bHLH121 396 dysfunction, we first examined the effects of reduced glutathione (GSH) and potassium 397 iodide (KI), two H 2 O 2 scavengers, on salt stress-induced root growth inhibition. 398 Although substantial growth inhibition of _bhlh121-7_ seedlings was observed with both 399 500 μM KI and 200 μM GSH in the absence of NaCl (Fig. 3A, B), under salt stress both 400 KI and GSH restored root growth more effectively in _bhlh121-7_ than in WT, resulting 401 in root growth recovery with KI (WT, −6.1% vs. _bhlh121-7_, +9.5%) and with GSH 402 (WT, +4.4% vs. _bhlh121-7_, +10.0%) (Fig. 3A, C). 403 Since superoxide (O 2 [•] **[−]** ) and H 2 O 2 are two major ROS involved in root tip growth 404 under salt stress (Dang et al., 2025), their accumulation was detected using nitroblue 405 tetrazolium (NBT) staining for O 2 [•] **[−]** (Tsukagoshi et al., 2010) and 3,3′ 406 diaminobenzidine (DAB) staining for H 2 O 2 (Daudi et al., 2012). In line with this, ROS 407 staining showed reduced H 2 O 2 accumulation in the presence of KI or GSH under salt 408 stress (Fig. 3D). Notably, O 2 [•] **[−]** levels indicated by NBT staining were comparable in 409 _bhlh121-7_ and WT under control conditions, whereas slight decreases were observed 410 in the mutant under NaCl treatment (Fig. 3D). Importantly, KI and GSH mitigated salt 411 induced perturbations in O 2 [•] **[−]** levels. Moreover, ROS homeostasis was also restored in 412 bHLH121 complementation lines (Supplementary Fig. S4). These results strongly 413 suggest that bHLH121 is crucial for maintaining ROS homeostasis in roots under high 414 salinity. 415 ROS spatiotemporal dynamics are vital for plant growth and stress responses. We 416 sought to determine whether ROS imbalance occurs shortly after exposure to high [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 417 salinity. To this end, we monitored ROS levels at 0, 3, 6, 12, and 24 h after NaCl 418 treatment in the roots of seedlings. Significant differences in O 2 [•] **[−]** and H 2 O 2 signal 419 intensities in root tips were observed after 6 h of salt treatment (Fig. 4). For O 2 [•−], the 420 two peaks and one trough of NBT signals indicate maximum and minimum O 2 [•−] levels 421 across the root apical meristem. Salt treatment disrupted the O 2 [•] **[−]** distribution pattern in 422 both WT and the mutant (Fig. 4A–C). For DAB staining reflecting H 2 O 2 distribution, 423 peak signals were predominantly shifted toward the late meristem and elongation zone 424 in control plants (Fig. 4, D–F). Comparable H 2 O 2 signal intensities were captured in 425 WT, _bhlh121-7_, and bHLH121-complemented lines without NaCl (Fig. 4). In contrast, 426 after NaCl treatment, H 2 O 2 levels in the _bhlh121-7_ mutant were dramatically increased 427 and significantly higher than those in WT and salt-insensitive mutants (Fig. 4D–F). Salt 428 stress also triggered H 2 O 2 accumulation beyond the meristem and elongation zones (Fig. 429 4D–F). These results indicate that ROS balance is acutely disrupted in the _bhlh121-7_ 430 mutant, with the O 2 [•−] / H 2 O 2 ratio significantly decreased compared with WT under salt 431 stress. 432 **3.4 bHLH121 is required for root apical meristem maintenance in salt-stressed** 433 **roots** 434 Since root apical meristem (RAM) size is a major determinant of root growth rate, we 435 reasoned that the markedly shorter roots of _bhlh121-7_ than of WT plants might result 436 from an impaired RAM. To test this possibility, we measured RAM size in salt-treated 437 _bhlh121-7_ plants. As expected, RAM size in salt-treated roots decreased by ~63.9% in 438 _bhlh121-7_ versus ~30.2% in WT (Fig. 5A–D), whereas the number of RAM cells 439 decreased by ~63.1% in _bhlh121-7_ vs. ~40.2% in WT (Fig. 5A, B, E, F). These results 440 suggest that bHLH121 plays an important role in RAM maintenance under salt stress. 441 Given that root apical meristem (RAM) size is determined by the O 2 [•−] to H 2 O 2 ratio 442 gradients in the root tip (Dang et al., 2025; Tsukagoshi, 2016), we suspected that the 443 rapid disruption of ROS balance negatively affected RAM size. To test whether 444 modifying oxidative conditions could restore WT-like salt tolerance and RAM size, we [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 445 treated the _bhlh121-7_ mutant with GSH and KI. Consistent with previous results (Fig. 446 3), both KI and GSH substantially alleviated salt stress-induced root growth inhibition 447 in _bhlh121-7_ . Notably, in WT plants, while KI and GSH slightly reduced RAM cell 448 number under control conditions, they had minimal impact on RAM size under salt 449 stress (Fig. 5A, C, E). Nevertheless, both chemicals effectively restored RAM length 450 and cell number, which were severely reduced by high salinity (Fig. 5B, D, F). We also 451 examined the expression levels of _PLETHORA1_ ( _PLT1_ ) and _PLT2_, two key genes 452 required for RAM maintenance (Aida et al., 2004). In agreement with our mRNA-seq 453 results, both genes were notably upregulated upon salt stress and displayed significantly 454 higher expression levels in _bhlh121-7_ than in WT (Fig. 5G, H), suggesting that 455 bHLH121 dysfunction alters the regulation of RAM maintenance genes. 456 Altogether, these findings suggest that loss of bHLH121 function results in ROS 457 imbalance in root tips, presumably exacerbating salt-induced root growth inhibition by 458 interfering with meristem maintenance. 459 **3.5 Transcriptome analyses support a role for bHLH121 in ROS homeostasis** 460 **under salt stress** 461 Based on the above results, we speculated that bHLH121 is required for maintaining 462 RAM size to sustain root growth under high salinity. To obtain molecular evidence, we 463 performed mRNA-seq on roots of 10-day-old seedlings grown in ES medium and 464 treated with or without 100 mM NaCl. Under control conditions, 207 differentially 465 expressed genes (DEGs) were identified in _bhlh121-7_ roots compared with WT, 466 comprising 157 upregulated and 50 downregulated genes (Supplementary Fig. S5; 467 Supplementary Table S2). Consistent with previously described mRNA-seq results for 468 _uri-1_ (Kim et al., 2019), Fe deficiency-responsive genes such as _FRO2_ and _IRT1_ were 469 remarkably downregulated in _bhlh121-7_ (Supplementary Fig. S5C). In contrast, 470 _IMA1/2_ and _bHLH100/101_ were substantially upregulated (Supplementary Fig. S5C), 471 likely reflecting a compensatory feedback response to the loss of bHLH121, which 472 phenocopies Fe deficiency (Wang et al., 2024). [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 473 For salt-responsive genes, 886 (377 upregulated and 509 downregulated) and 1374 474 (517 upregulated and 857 downregulated) DEGs were identified in WT and _bhlh121-7_ 475 roots, respectively (Fig. 6A, B; Supplementary Tables S3 and S4). Gene Ontology (GO) 476 enrichment analyses revealed both overlapping (Supplementary Fig. S6) and specific 477 biological processes in WT and _bhlh121-7_ samples (Fig. 6C–F). For example, many 478 DEGs in both WT and _bhlh121-7_ roots are involved in stress, water deprivation, 479 hormone responses, hypoxia, cell wall organization or biogenesis, and defense 480 responses (Supplementary Fig. S6). In contrast, cell wall loosening, L-glutamate 481 transmembrane transport, and amino acid transport were the top enriched GO terms 482 specific to WT (Fig. 6C, D). In the _bhlh121-7_ mutant, jasmonic acid (JA) response, 483 suberin biosynthetic process, and xylem development were the most significantly 484 enriched biological processes (Fig. 6E, F). 485 Notably, DEGs associated with JA response were upregulated in _bhlh121-7_, whereas 486 genes involved in the hydrogen peroxide (H 2 O 2 ) catabolic process were downregulated 487 in WT (Fig. 6C–F). Given that ROS homeostasis in _Arabidopsis_ roots is tightly 488 regulated during stress responses, these results align with our earlier physiological 489 analyses. We hypothesized that bHLH121 is required to suppress salt stress-induced 490 ROS bursts. This prompted us to investigate which genes in ROS metabolic pathways 491 were significantly changed in _bhlh121-7_ under salt stress. We first examined the 492 expression profiles of _RBOH_ genes, which encode ROS-producing enzymes that 493 generate superoxide anions (O 2 [•−] ) and H 2 O 2 in response to stress (Mittler et al., 2022). 494 Most _RBOH_ genes detected in our mRNA-seq data showed no obvious expression 495 changes, except for _RBOHD_ and _RBOHF_ (Supplementary Fig. S7A). Moreover, most 496 genes encoding superoxide dismutases (SODs; except FSD1) and peroxiredoxins 497 (PRXs) were upregulated in WT but showed impaired induction (e.g., PRX8) or even 498 downregulation in _bhlh121-7_ (Supplementary Fig. S7B). 499 To further validate their salt-induced responses, we performed qRT-PCR for the ROS 500 metabolic genes _RBOHD_, _PRX8_, and _CAT2_ (Fig. 6G–I). _CAT2_ was selected because of [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 501 its important role in H 2 O 2 scavenging under salt stress (Hu et al., 2026; Liu et al., 2025; 502 Zhuang et al., 2025). In the absence of NaCl, _RBOHD_ and _PRX8_ showed comparable 503 expression in _bhlh121-7_ and WT. After 10 days of salt treatment, _RBOHD_ was slightly 504 induced in _bhlh121-7_ relative to WT, whereas _PRX8_ induction was suppressed (Fig. 505 6G, H). In contrast, _CAT2_ expression was lower in _bhlh121-7_ than in WT under control 506 conditions, and NaCl had minimal effect on _CAT2_ expression in both genotypes (Fig. 507 6I). These results are in line with our transcriptome analyses, suggesting that loss of 508 bHLH121 impairs the regulation of key genes involved in ROS metabolism. 509 Collectively, these results suggest that bHLH121 mediates transcriptional adaptation 510 to salt stress. Specifically, antioxidant responses are upregulated by bHLH121 under 511 high salinity, suggesting an important role for bHLH121 in maintaining ROS 512 homeostasis during salt stress. 513 **3.6 Overexpression of** _**CAT2**_ **restore redox homeostasis and salt sensitivity of** 514 _**bhlh121**_ **mutant** 515 Since _CAT2_ was downregulated in the _bhlh121_ mutant (Fig. 6I) and was previously 516 identified as one of the binding targets of bHLH121 in planta by ChIP-seq (Kim et al., 517 2019), we asked whether bHLH121 modulates ROS homeostasis by regulating _CAT2_ 518 expression. To test this hypothesis, we first examined the direct binding of bHLH121 519 to the _CAT2_ promoter using an electrophoretic mobility shift assay (EMSA). As shown 520 in Fig. 7A, a biotin-labeled _CAT2_ promoter probe (Biotin- _CAT2_ ) formed a specific 521 protein–DNA complex with recombinant bHLH121, whereas no such shifted band was 522 detected when the His-TF tag protein was used as a negative control. The specificity of 523 this interaction was further confirmed by competition assays: the addition of excess 524 unlabeled probe (Cold- _CAT2_ ) effectively diminished the shifted band, whereas the 525 mutated probe with disrupted E-box motifs (Cold- _CAT2-m_ ) failed to compete for 526 binding, indicating that bHLH121 directly associates with the _CAT2_ promoter through 527 the E-box element. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 528 To determine whether _CAT2_ acts genetically downstream of bHLH121 in mediating 529 salt tolerance, we generated transgenic lines overexpressing _CAT2_ under the control of 530 the 35S promoter in the _bhlh121-7_ mutant background ( _35S::CAT2_ / _bhlh121-7_ ). When 531 grown on ES medium supplemented with 100 mM NaCl for 10 d, the 532 _35S::CAT2/bhlh121-7_ transgenic lines showed significantly improved shoot and root 533 growth and greener leaves relative to the _bhlh121-7_ mutant (Fig. 7B). Quantitative 534 reverse transcription PCR (qRT-PCR) analysis confirmed that _CAT2_ transcript levels 535 were significantly elevated in the _35S::CAT2/bhlh121-7_ lines compared with both WT 536 and the _bhlh121-7_ mutant (Fig. 7C), confirming successful overexpression of _CAT2_ in 537 the tested transgenic lines. We further quantified physiological parameters to evaluate 538 the extent of phenotypic rescue. The results showed that the _35S::CAT2/bhlh121-7_ lines 539 largely restored root length and fresh weight to levels approaching those of WT plants 540 (Fig. 7D, E). In addition, chlorophyll content, which was substantially decreased in the 541 _bhlh121-7_ mutant due to stress-induced chlorosis, was significantly increased in the 542 _35S::CAT2/bhlh121-7_ plants (Fig. 7F). Notably, we also examined the phenotypes of 543 _35S::CAT2/bhlh121-7_ plants grown on ES medium under low-iron conditions (0 μM 544 Fe) for 10 d. Interestingly, unlike the rescue observed under salt stress, the 545 _35S::CAT2/bhlh121-7_ plants did not rescue the growth inhibition or leaf chlorosis of 546 the _bhlh121-7_ mutant under Fe-deficient conditions (Fig. 7B–F), suggesting that the 547 bHLH121–CAT2 module acts independently of Fe homeostasis. 548 To further corroborate that _CAT2_ overexpression alleviates the salt hypersensitivity 549 of the _bhlh121_ mutant by restoring ROS homeostasis, we first measured the H 2 O 2 550 content in roots. As expected, salt stress caused an increase in H 2 O 2 content, but no 551 significant difference was observed among WT, _bhlh121_ mutant, and 552 _35S::CAT2/bhlh121_ seedling roots (Fig. 8A). We then determined CAT activity in roots. 553 CAT activity increased under salt stress, but differences were observed among lines: it 554 was significantly reduced in the _bhlh121_ mutant, whereas overexpression of _CAT2_ 555 restored the activity to WT levels in _35S::CAT2/bhlh121_ seedling roots (Fig. 8B). By [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 556 contrast, POD activity also increased under salt stress, but the differences among lines 557 were not significant, suggesting that POD may not be the main contributor to the salt 558 sensitivity of the _bhlh121_ mutant (Fig. 8C). Notably, SOD activity decreased under salt 559 stress, possibly due to the prolonged stress duration, and no difference was detected 560 among the tested lines (Fig. 8D). Together, these results support that CAT2 alleviates 561 the salt-sensitive root phenotype of the _bhlh121_ mutant by mitigating abnormal H 2 O 2 562 accumulation. 563 To monitor the distributions of superoxide anion (O 2 [•–] ) and hydrogen peroxide (H 2 O 2 ) 564 in root tips, NBT and DAB staining were performed, respectively. Consistent with 565 previous results (Figs. 3 and 4), no obvious differences in O 2 [•–] levels were detected 566 among the tested genotypes under either control or salt conditions (Fig. 9A–C). In 567 contrast, all three tested _35S::CAT2/bhlh121-7_ lines displayed substantially reduced 568 staining signals for salt-induced H 2 O 2, with levels comparable to those of WT plants 569 (Fig. 9D). Quantitative analysis of the gray values along linear regions of interest (ROIs) 570 extending 2 mm from the root tip further confirmed that _CAT2_ overexpression 571 effectively attenuated the salt-induced ROS burst in the _bhlh121-7_ mutant (Fig. 9E, F). 572 These results provide histochemical evidence that _CAT2_ overexpression restores ROS 573 homeostasis in the root tips of the _bhlh121_ mutant under salt stress. 574 Collectively, these results demonstrate that _CAT2_ overexpression potently rescues 575 the salt-sensitive phenotype of the _bhlh121_ mutant, supporting the notion that 576 bHLH121 functions upstream of _CAT2_ to regulate salt tolerance, at least in part, by 577 modulating ROS homeostasis through CAT2-mediated H 2 O 2 scavenging. 578 **3.7 Auxin and JA pathways are affected in the** _**bhlh121-7**_ **mutant** 579 ROS homeostasis is tightly associated with hormone signaling in multiple aspects of 580 plant stress responses. Apart from ROS homeostasis genes, comparative transcriptome 581 analysis under salt stress identified a set of upregulated genes specific to _bhlh121-7_ . 582 Among these, JA biosynthesis and signaling pathways were significantly enriched (Fig. 583 6E). Consistently, a number of genes involved in JA biosynthesis, metabolism, and [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 584 signaling were significantly upregulated in the _bhlh121-7_ mutant compared with WT 585 (Supplementary Fig. S8A). Furthermore, we observed a distinct expression pattern of 586 auxin-related genes, most of which were downregulated in the _bhlh121-7_ mutant 587 compared with WT (Supplementary Fig. S8B). 588 To determine whether JA and auxin signaling contribute to the reduced salt tolerance 589 of the _bhlh121-7_ mutant, we performed pharmacological tests using the JA biosynthesis 590 inhibitor DIECA (Farmer et al., 1994) and the auxin IAA. For the JA pathway, all tested 591 concentrations of exogenous DIECA (25, 50, and 100 μM) effectively enhanced root 592 growth of the _bhlh121-7_ mutant under salt stress, whereas in WT plants it had no effect 593 or was inhibitory at high concentrations (Fig. 10A–C). Similarly, for the auxin pathway, 594 all tested concentrations of exogenous IAA (10, 50, and 100 nM) suppressed root 595 growth in both the _bhlh121-7_ mutant and WT under control conditions, whereas they 596 significantly restored root growth in the _bhlh121-7_ mutant but not in WT under salt 597 stress (Fig.10D–F). We further examined the expression levels of three key genes 598 involved in JA signaling ( _JAZ1_ and _JAZ10_ ) (Liu et al., 2021a) and auxin homeostasis 599 ( _GH3.15_ ) (Sherp et al., 2018) in response to salt in the _bhlh121-7_ mutant. Consistent 600 with the transcriptome analyses, both _JAZ1_ and _JAZ10_ were strongly induced in salt 601 stressed _bhlh121-7_ but not in WT (Fig. 10G, H), suggesting that JA signaling is 602 activated in the _bhlh121-7_ mutant. Similarly, _GH3.15_ displayed much higher induction 603 in _bhlh121-7_ than in WT (Fig. 10I), supporting the notion that bHLH121 functions in 604 maintaining auxin homeostasis. 605 Overall, these findings suggest that bHLH121 is important for modulating both JA 606 signaling and auxin homeostasis under salt stress, thereby contributing to salt tolerance 607 in WT plants. 608 **3.8 Conserved function of bHLH121 in salt tolerance across several dicot species** 609 To assess the potential of bHLH121 for crop improvement, we investigated whether its 610 function in salt tolerance is conserved across several plant species. Putative bHLH121 611 homologs from _Populus trichocarpa_, _Glycine soja_, _Cucumis sativus_, and _Citrus_ [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 612 _clementina_ were previously expressed in the _bhlh121-7_ mutant and showed conserved 613 function in the Fe deficiency response (Zhou et al., 2026). Using the same transgenic 614 plants, we tested whether overexpression of these bHLH121 homologous genes rescued 615 the salt hypersensitivity of the _bhlh121-7_ mutant. Indeed, all four genes substantially 616 rescued the salt-sensitive phenotypes in both roots (Fig. 11) and shoots (Supplementary 617 Fig. S9). Consistent with the effect of _bHLH121_ overexpression in WT (Fig. 1A), 618 _bHLH121_ overexpression in the _bhlh121-7_ mutant restored root length and seedling 619 fresh weight to WT-like levels but did not enhance salt tolerance beyond WT levels 620 (Fig. 11). Altogether, these results suggest that the role of bHLH121 in conferring salt 621 tolerance is conserved in several dicot species, highlighting the potential of using 622 bHLH121 homologs to improve salt tolerance across a broad range of dicot crops. # 623 4 Discussion 624 The escalating challenge of soil salinity, intensified by global climate change, poses a 625 significant threat to agricultural productivity and food security worldwide. Salinity 626 severely constrains plant growth and yield, and decades of research have sought to 627 unravel the molecular underpinnings of salt stress responses. Seminal work, such as the 628 identification of the Salt Overly Sensitive (SOS) signaling pathway, provided 629 foundational insights into ionic homeostasis (Yang et al., 2018; Zhu, 2002). Despite 630 these advances, the genetic arsenal available for engineering salt-tolerant crops remains 631 limited, underscoring the need to identify novel regulatory components. Intriguingly, 632 recent findings demonstrate that Fe homeostasis components can coordinately regulate 633 both Fe nutrition and salt tolerance across diverse plant species (Li et al., 2017; Liang 634 et al., 2022; Zhang et al., 2025), suggesting an intrinsic link between the Fe homeostasis 635 regulatory network and salt stress responses. However, the mechanistic link 636 coordinating Fe homeostasis and salt adaptation has remained elusive. Our study 637 identifies the transcription factor bHLH121 as a previously unrecognized central player 638 in salt tolerance. The _bhlh121_ mutant exhibited profound hypersensitivity. This distinct 639 phenotype positions bHLH121 not merely as a conduit for Fe-deficiency signals but as [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 640 a potential integrator of Fe homeostasis and salt stress adaptation. Further 641 transcriptomic and biochemical evidence indicates that the bHLH121–CAT2 module 642 exerts its essential function by modulating the redox homeostasis within the root apex, 643 thereby preserving meristem activity and root growth under saline conditions 644 (Supplementary Fig. S10). These findings provide insight into how a core Fe signaling 645 component is co-opted to mediate oxidative stress management, offering a fresh 646 perspective on the interplay between nutrient sensing and abiotic stress resilience. 647 Recent studies suggest that peanut bHLH121 functions beyond Fe homeostasis by 648 targeting ROS-related genes such as _SOD_, _POD_, and _CAT_ (Zhao et al., 2024), which 649 are well-documented regulators of plant growth and stress responses. The present work 650 establishes a specific role for the bHLH121–CAT2 module in salt tolerance in 651 _Arabidopsis_ . Although Fe homeostasis is tightly associated with ROS dynamics, our 652 results indicate that _CAT2_ overexpression rescues salt hypersensitivity but not Fe 653 deficiency-related growth defects (Fig. 7), strongly suggesting an Fe homeostasis– 654 independent axis regulated by the bHLH121–CAT2 module. Direct binding of 655 bHLH121 to the _CAT2_ promoter was previously observed by ChIP-seq (Kim et al., 656 2019), and we confirmed this direct binding in vitro (Fig. 7A). Nevertheless, whether 657 additional factors are required for _CAT2_ expression remains to be investigated. Given 658 that bHLH121 interacts and cooperates with IVc bHLH transcription factors to regulate 659 downstream targets in the Fe regulatory network, likely because it lacks an activation 660 or repression domain (Lei et al., 2020), we hypothesize that bHLH121 may similarly 661 function as part of a transcriptional complex responsible for salt stress resilience. 662 The WT-like salt-tolerant phenotypes of complementation and overexpression 663 transgenic lines, regardless of _bHLH121_ expression levels, suggest that bHLH121 may 664 undergo post-transcriptional modification for its function in salt tolerance. In fact, 665 phosphorylation of bHLH121 is crucial for the Fe deficiency response in _Arabidopsis_ 666 (Kim et al., 2019), raising the intriguing question of whether phosphorylation also 667 contributes to its role in regulating plant salt tolerance. Moreover, SOS2 from the SOS [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 668 pathway is a well-documented salt stress-activated kinase that phosphorylates a subset 669 of target proteins associated with ion nutrition (Ma et al., 2025). Although our results 670 suggest that bHLH121 may act in parallel with SOS2 under salt stress, potential 671 interactions between bHLH121 downstream targets, such as transporters, and SOS2 672 cannot be excluded. 673 Our results further indicate the involvement of JA and auxin signaling components 674 in bHLH121-mediated salt tolerance. The salt hypersensitivity of _bhlh121_ mutant roots 675 may arise from a detrimental interplay between disrupted ROS homeostasis and 676 hormone signaling. Overproduction of ROS, driven by _RBOHD_ overexpression, 677 coupled with impaired scavenging capacity reflected by low _CAT2_ and _PRX8_ 678 expression (Fig. 6), creates severe oxidative stress. This directly damages root cells and 679 is further amplified by hyperactivation of the JA pathway, as evidenced by feedback 680 upregulation of _JAZ1_ and _JAZ10_ (Fig. 10). Concurrently, the _bhlh121-7_ mutant initiates 681 a maladaptive stress response by drastically suppressing auxin levels through induction 682 of the auxin-inactivating enzyme _GH3.15_ (Sherp et al., 2018). This represents an 683 extreme growth–defense trade-off, in which resources are diverted from growth at an 684 excessive cost. The resulting combination of rampant oxidative damage and near 685 complete shutdown of growth-promoting auxin signaling arrests root development. 686 Phenotypic rescue achieved by inhibiting JA synthesis with DIECA or by supplying 687 exogenous auxin confirms this mechanistic model: DIECA dampens the JA–ROS 688 feedback loop, alleviating oxidative stress, while external IAA bypasses the internal 689 auxin blockade to reactivate growth. Thus, the _bhlh121_ mutant phenotype emerges from 690 a pathologically reinforced network in which ROS, JA, and auxin signals synergize to 691 lock the plant in an over-defensive state, ultimately compromising fitness under salt 692 stress (Supplementary Fig. S10). The precise molecular mechanism(s) by which 693 bHLH121 coordinates JA and auxin signaling warrant further investigation. 694 Catalases play a pivotal role in plant detoxification by mitigating ROS accumulation 695 under abiotic stress (Li et al., 2015; Mhamdi et al., 2012; Zhang et al., 2021). These [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 696 enzymes catalyze the dismutation of two H 2 O 2 molecules into H 2 O and molecular 697 oxygen (Frugoli et al., 1996). The Arabidopsis genome encodes three catalase isoforms, 698 CAT1, CAT2, and CAT3, each consisting of 492 amino acids with high sequence 699 similarity (Frugoli et al., 1996; Mhamdi et al., 2010). Among these, CAT2 is the 700 predominant isoform, accounting for approximately 80% of total catalase activity, 701 whereas loss of CAT3 causes only minor reductions and CAT1 deletion has negligible 702 effects (Du et al., 2008; Mhamdi et al., 2010; Zou et al., 2015). Consistent with this 703 hierarchy, the _cat1 cat2 cat3_ triple mutant displays severe redox homeostasis disruption 704 and hypersensitivity to salt stress (Su et al., 2018). Further supporting the conserved 705 role of catalases in stress adaptation, silencing of _SmCAT4_ in eggplant ( _Solanum_ 706 _melongena_ ) compromises salt tolerance, concomitant with elevated H 2 O 2 accumulation 707 and diminished catalase activity (Shen et al., 2023). Moreover, jasmonic acid modulates 708 salt tolerance through MYC2-mediated transcriptional repression of _CAT2_ (Song et al., 709 2021), while the CRCK3–CAT2 module contributes to salt stress resilience by 710 maintaining cellular redox homeostasis (Zhuang et al., 2025). Recent findings reveal 711 an additional layer of CAT2 regulation: a redox-regulated RCC1-like protein, CAIR1, 712 controls catalase activity by facilitating its peroxisomal import and preventing its 713 aggregation (Hu et al., 2026). These findings underscore the essential function of 714 catalases in plant adaptive responses to environmental stresses and provide a 715 mechanistic context for the bHLH121–CAT2 axis described here. 716 ROS dynamics in plants constitute a crucial signaling hub that governs growth, 717 development, and stress adaptation (Castro et al., 2021; Mittler et al., 2022; Tsukagoshi, 718 2016). The production of ROS via the Fenton reaction (Halliwell et al., 1992) highlights 719 an intrinsic link between ROS dynamics and Fe homeostasis; however, the precise 720 interplay between Fe nutrition and the ROS burst triggered by salt stress remains poorly 721 understood. Though the present study suggests that bHLH121–CAT2 module acts 722 independently of Fe homeostasis regulatory genes (Fig. 7), we cannot exclude the 723 possibility that bHLH121 regulates salt tolerance in an Fe-dependent manner. It is [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 724 important to emphasize that Fe homeostasis encompasses multiple dynamic processes, 725 including uptake, transport, distribution, storage, and allocation, and is systemically 726 regulated (Liang, 2022; Wang et al., 2024). Based on the present data, we propose that 727 bHLH121 specifically mediates the integration of systemic Fe signaling with stress 728 responses, including ROS and hormone signaling. A recent study highlighted the role 729 of heat-induced nutritional stress under prolonged high-temperature conditions and 730 suggested that Fe homeostasis represents a promising target for enhancing crop 731 resilience to climate extremes (Minami et al., 2025). Whether bHLH121 also functions 732 in plant responses to environmental stresses beyond salinity constitutes an important 733 direction for future research. 734 In response to stress, plant roots, as the primary interface sensing the external 735 environment, rapidly curtail growth to reallocate resources—a strategic adaptation that 736 hinges on precise regulation of meristematic activity (Liu et al., 2015; Motte et al., 737 2019). Salt-induced ROS bursts in the root tip are harmful and cause growth arrest and 738 cellular dysfunction (Dang et al., 2025; Xie et al., 2011). Critically, the size of the root 739 apical meristem is determined by the spatial gradient of the O 2 [•] **[−]** to H 2 O 2 ratio 740 (Tsukagoshi, 2016; Tsukagoshi et al., 2010). Therefore, ROS homeostasis in the root 741 must be tightly controlled during plant stress responses. The spatiotemporal dynamics 742 of ROS are intricately governed by numerous nonenzymatic antioxidants and 743 detoxifying enzymes regulated by hormone signaling, Ca [2+] fluxes, and MAPK cascades 744 (Castro et al., 2021). However, the identity of upstream regulators that fine-tune this 745 localized redox landscape has remained elusive. Our identification of bHLH121 as a 746 regulator of _CAT2_ expression and ROS homeostasis in the root apex provides a 747 candidate for such an upstream regulator and offers a framework for understanding how 748 Fe signaling components are integrated into salt stress responses. 749 In agricultural practice, managing micronutrients such as Fe to enhance plant 750 tolerance and secure crop yield in saline soils remains challenging (Kong et al., 2022; 751 Yan et al., 2023). H 2 O 2, for instance, has been proposed as a potential crop growth [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 752 regulator (Iqbal et al., 2025). Our study provides mechanistic insights that may underlie 753 the additive effects of combining such strategies to combat high salinity. Further 754 investigation is needed to determine whether stress-induced ROS patterns or the 755 artificial application of ROS reciprocally influence Fe homeostasis. In conclusion, this 756 study not only advances our understanding of the physiological and molecular 757 mechanisms underlying bHLH121-mediated salt tolerance but also opens avenues for 758 bHLH121-based molecular strategies to enhance crop resilience against salinity stress, 759 a challenge likely to be intensified by global climate change. # 760 Author contributions 761 P.L., C.L., and R.W. conceived and designed the experiments; P.Z., Y.P., R.W., Y.F., 762 B.L., and X.D. performed the experiments; P.L. and C.L. performed the mRNA-seq 763 analysis; C.L. and R.W. helped with the data analysis; C.L., P.Z., R.S., Y.C, M.I.H. and 764 P.L. wrote and revised the article; P.L., C.L., L.L., R.S., and Y.C. provided funding. All 765 authors contributed to the review and editing of the manuscript. # 766 Acknowledgements 767 We thank Prof. Yan Guo (China Agricultural University) for kindly sharing _sos2-T1_ 768 seeds _._ This work was supported by the National Natural Science Foundation of China 769 (No. 32300274, No. 32070279), National Key R&D Program of China (No. 770 2023YFD1702205), Project of Priority and Key Areas, Institute of Soil Science, 771 Chinese Academy of Sciences (No. ISSASIP2222, No. ISSASIP2206), and Natural 772 Science Foundation of Jiangsu Province (No. BK20221560). # 773 Supplementary data 774 **Supplementary Figure S1** Gene expression analysis of _bHLH121_ in _Arabidopsis_ 775 seedlings in response to salt stress 776 **Supplementary Figure S2** Both _bhlh121-7_ and _bhlh121-8_ mutants show 777 hypersensitivity to salt stress 778 **Supplementary Figure S3** The full-length _bHLH121_ gene rescues the salt 779 hypersensitivity of the _bhlh121_ mutant [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 780 **Supplementary Figure S4** The full-length _bHLH121_ gene rescues ROS imbalance in 781 the _bhlh121-7_ mutant under salt stress 782 **Supplementary Figure S5** Gene Ontology (GO) and heatmap analyses of differentially 783 expressed genes (DEGs) between WT and _bhlh121-7_ mutant 784 **Supplementary Figure S6** Gene Ontology (GO) enrichment analysis of shared 785 differentially expressed genes (DEGs) in salt-stressed WT and _bhlh121-7_ roots 786 **Supplementary Figure S7** Heatmap analysis of ROS related genes in WT and _bhlh121_ 787 mutant under salt stress 788 **Supplementary Figure S8** Transcriptome analyses indicate the involvement of 789 jasmonic acid (JA) signaling and auxin homeostasis in the salt-sensitive phenotype of 790 the _bhlh121-7_ mutant 791 **Supplementary Figure S9** Effects of ectopic expression of _bHLH121_ homologous 792 genes in the _bhlh121-7_ mutant under salt stress 793 **Supplementary Figure S10** A proposed working model illustrating the role of 794 bHLH121 in maintaining RAM size and root tip growth under salt stress in _Arabidopsis_ 795 **Supplementary Table S1.** Oligos used in this study 796 **Supplementary Table S2.** List of differentially expressed genes in the roots between 797 WT and _bhlh121-7_ mutant 798 **Supplementary Table S3.** List of salt-responsive differentially expressed genes in the 799 roots of WT 800 **Supplementary Table S4.** List of salt-responsive differentially expressed genes in 801 the roots of _bhlh121-7_ mutant # 802 Conflicts of interest 803 The authors declare that they have no conflict of interest. # 804 Data availability statement 805 All data generated or analyzed during this study are included in this published article 806 and online Supplementary data file. The raw data of mRNA-seq presented in this paper 807 have been deposited in the NCBI BioProject database under accession PRJNA1301088. # 808 References 809 810 Aida, M., Beis, D., Heidstra, R., Willemsen, V., Blilou, I., Galinha, C., Nussaume, L., Noh, Y. S., 811 Amasino, R., & Scheres, B. (2004). The PLETHORA genes mediate patterning of the 812 Arabidopsis root stem cell niche. _Cell, 119_ (1), 109-120. doi:10.1016/j.cell.2004.09.018 813 Arnon, D. I. (1949). Copper Enzymes in Isolated Chloroplasts. Polyphenoloxidase in Beta Vulgaris. 814 _Plant Physiol, 24_ (1), 1-15. doi:10.1104/pp.24.1.1 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 815 Briat, J. F., Dubos, C., & Gaymard, F. (2015). Iron nutrition, biomass production, and plant product 816 quality. _Trends in Plant Science, 20_ (1), 33-40. doi:10.1016/j.tplants.2014.07.005 817 Castro, B., Citterico, M., Kimura, S., Stevens, D. M., Wrzaczek, M., & Coaker, G. (2021). Stress 818 induced reactive oxygen species compartmentalization, perception and signalling. 819 _Nature Plants, 7_ (4), 403-412. doi:10.1038/s41477-021-00887-0 820 Cheng, C. Y., Krishnakumar, V., Chan, A. P., Thibaud-Nissen, F., Schobel, S., & Town, C. D. (2017). 821 Araport11: a complete reannotation of the Arabidopsis thaliana reference genome. _Plant_ 822 _Journal, 89_ (4), 789-804. doi:10.1111/tpj.13415 823 Colangelo, E. P., & Guerinot, M. L. (2004). The essential basic helix-loop-helix protein FIT1 is 824 required for the iron deficiency response. _Plant Cell, 16_ (12), 3400-3412. doi:DOI 825 10.1105/tpc.104.024315 826 Dai, M. T., Huang, R. S., Han, Y. Y., Zhang, Z. Y., Chen, Y. Y., Shi, H. F., & Guo, Z. F. (2022). A novel 827 salt responsive PvHAK16 negatively regulates salt tolerance in transgenic Arabidopsis 828 thaliana. _Environmental and Experimental Botany, 194_ . 829 doi:10.1016/j.envexpbot.2021.104689 830 Dai, W. S., Wang, M., Gong, X. Q., & Liu, J. H. (2018). The transcription factor FcWRKY40 of 831 Fortunella crassifolia functions positively in salt tolerance through modulation of ion 832 homeostasis and proline biosynthesis by directly regulating SOS2 and P5CS1 homologs. 833 _New Phytologist, 219_ (3), 972-989. doi:10.1111/nph.15240 834 Dang, T. V. T., Cho, H. S., Lee, S., & Hwang, I. (2025). Salt stress-accelerated proteasomal 835 degradation of LBD11 suppresses ROS-mediated meristem development and root 836 growth in Arabidopsis. _Plant Communications, 6_ (4). doi:10.1016/j.xplc.2025.101241 837 Daudi, A., Cheng, Z. Y., O'Brien, J. A., Mammarella, N., Khan, S., Ausubel, F. M., & Bolwell, G. P. 838 (2012). The Apoplastic Oxidative Burst Peroxidase in Arabidopsis Is a Major Component 839 of Pattern-Triggered Immunity. _Plant Cell, 24_ (1), 275-287. doi:10.1105/tpc.111.093039 840 Dello Ioio, R., Linhares, F. S., Scacchi, E., Casamitjana-Martinez, E., Heidstra, R., Costantino, P., & 841 Sabatini, S. (2007). Cytokinins determine Arabidopsis root-meristem size by controlling 842 cell differentiation. _Current Biology, 17_ (8), 678-682. doi:10.1016/j.cub.2007.02.047 843 Du, Y. Y., Wang, P. C., Chen, J., & Song, C. P. (2008). Comprehensive functional analysis of the 844 catalase gene family in Arabidopsis thaliana. _J Integr Plant Biol, 50_ (10), 1318-1326. 845 doi:10.1111/j.1744-7909.2008.00741.x 846 Estelle, M. A., & Somerville, C. (1987). Auxin-Resistant Mutants of Arabidopsis-Thaliana with an 847 Altered Morphology. _Molecular and General Genetics, 206_ (2), 200-206. doi:Doi 848 10.1007/Bf00333575 849 Farmer, E. E., Caldelari, D., Pearce, G., Walkersimmons, K., & Ryan, C. A. (1994). 850 Diethyldithiocarbamic Acid Inhibits the Octadecanoid Signaling Pathway for the Wound 851 Induction of Proteinase-Inhibitors in Tomato Leaves. _Plant Physiology, 106_ (1), 337-342. 852 doi:DOI 10.1104/pp.106.1.337 853 Frugoli, J. A., Zhong, H. H., Nuccio, M. L., McCourt, P., McPeek, M. A., Thomas, T. L., & McClung, 854 C. R. (1996). Catalase is encoded by a multigene family in Arabidopsis thaliana (L) 855 Heynh. _Plant Physiology, 112_ (1), 327-336. doi:DOI 10.1104/pp.112.1.327 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 856 Gao, F., Li, M., & Dubos, C. (2024). bHLH121 and clade IVc bHLH transcription factors 857 synergistically function to regulate iron homeostasis in Arabidopsis thaliana. _J Exp Bot,_ 858 _75_ (10), 2933-2950. doi:10.1093/jxb/erae072 859 Gao, F., Robe, K., Bettembourg, M., Navarro, N., Rofidal, V., Santoni, V., Gaymard, F., Vignols, F., 860 Roschzttardtz, H., Izquierdo, E., & Dubos, C. (2020). The transcription factor bHLH121 861 interacts with bHLH105 (ILR3) and its closest homologs to regulate iron homeostasis in 862 Arabidopsis. _Plant Cell, 32_ (2), 508-524. doi:10.1105/tpc.19.00541 863 Gupta, R., Verma, N., & Tewari, R. K. (2024). Micronutrient deficiency-induced oxidative stress in 864 plants. _Plant Cell Reports, 43_ (9), 213. doi:10.1007/s00299-024-03297-6 865 Halliwell, B., & Gutteridge, J. M. (1992). Biologically relevant metal ion-dependent hydroxyl 866 radical generation. An update. _FEBS Lett, 307_ (1), 108-112. doi:10.1016/0014 867 5793(92)80911-y 868 Hansch, R., & Mendel, R. R. (2009). Physiological functions of mineral micronutrients (Cu, Zn, Mn, 869 Fe, Ni, Mo, B, Cl). _Curr Opin Plant Biol, 12_ (3), 259-266. doi:10.1016/j.pbi.2009.05.006 870 Hodges, D. M., DeLong, J. M., Forney, C. F., & Prange, R. K. (1999). Improving the thiobarbituric 871 acid-reactive-substances assay for estimating lipid peroxidation in plant tissues 872 containing anthocyanin and other interfering compounds. _Planta, 207_ (4), 604-611. 873 doi:DOI 10.1007/s004250050524 874 Hong, J. P., Takeshi, Y., Kondou, Y., Schachtman, D. P., Matsui, M., & Shin, R. (2013). Identification 875 and characterization of transcription factors regulating Arabidopsis HAK5. _Plant Cell_ 876 _Physiol, 54_ (9), 1478-1490. doi:10.1093/pcp/pct094 877 Hu, Z. B., Stolze, S. C., Mhamdi, A., Van Breusegem, F., Nakagami, H., & Ulm, R. (2026). A redox 878 regulated RCC1-like protein controls catalase activity in Arabidopsis. _Nature_ 879 _Communications_ . doi:10.1038/s41467-026-76792-x 880 Iqbal, H., Yaning, C., Raza, S. T., Karim, S., Shareef, M., & Waqas, M. (2025). From Lab to Field: 881 Harnessing H(2)O(2)-Mediated Upregulation of Plant Capacities Under Abiotic Stresses. 882 _Physiol Plant, 177_ (5), e70488. doi:10.1111/ppl.70488 883 Karimi, S. M., Freund, M., Wager, B. M., Knoblauch, M., Fromm, J., H, M. M., Ache, P., Krischke, M., 884 Mueller, M. J., Muller, T., Dittrich, M., Geilfus, C. M., Alfarhan, A. H., Hedrich, R., & 885 Deeken, R. (2021). Under salt stress guard cells rewire ion transport and abscisic acid 886 signaling. _New Phytol, 231_ (3), 1040-1055. doi:10.1111/nph.17376 887 Kim, S. A., LaCroix, I. S., Gerber, S. A., & Guerinot, M. L. (2019). The iron deficiency response in 888 Arabidopsis thaliana requires the phosphorylated transcription factor URI. _Proc Natl_ 889 _Acad Sci U S A, 116_ (50), 24933-24942. doi:10.1073/pnas.1916892116 890 Kong, D., Khan, S. A., Wu, H., Liu, Y., & Ling, H. Q. (2022). Biofortification of iron and zinc in rice 891 and wheat. _J Integr Plant Biol, 64_ (6), 1157-1167. doi:10.1111/jipb.13262 892 Lei, R., Li, Y., Cai, Y., Li, C., Pu, M., Lu, C., Yang, Y., & Liang, G. (2020). bHLH121 functions as a 893 direct link that facilitates the activation of FIT by bHLH IVc transcription factors for 894 maintaining Fe homeostasis in Arabidopsis. _Mol Plant, 13_ (4), 634-649. 895 doi:10.1016/j.molp.2020.01.006 896 Li, J., Liu, J., Wang, G., Cha, J. Y., Li, G., Chen, S., Li, Z., Guo, J., Zhang, C., Yang, Y., Kim, W. Y., Yun, 897 D. J., Schumaker, K. S., Chen, Z., & Guo, Y. (2015). A chaperone function of NO [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 898 CATALASE ACTIVITY1 is required to maintain catalase activity and for multiple stress 899 responses in Arabidopsis. _Plant Cell, 27_ (3), 908-925. doi:10.1105/tpc.114.135095 900 Li, W. F., Han, X. W., & Lan, P. (2022). Emerging roles of protein phosphorylation in plant iron 901 homeostasis. _Trends in Plant Science, 27_ (9), 908-921. doi:10.1016/j.tplants.2022.03.012 902 Li, X. L., Zhang, H. M., Ai, Q., Liang, G., & Yu, D. Q. (2016). Two bHLH transcription factors, 903 bHLH34 and bHLH104, regulate iron homeostasis in Arabidopsis thaliana. _Plant_ 904 _Physiology, 170_ (4), 2478-2493. doi:10.1104/pp.15.01827 905 Li, Y. J., Fei, X. W., Wu, X. P., & Deng, X. D. (2017). Iron deficiency response gene _Femu2_ plays a 906 positive role in protecting _Chlamydomonas reinhardtii_ against salt stress. _Biochimica Et_ 907 _Biophysica Acta-General Subjects, 1861_ (1), 3345-3354. 908 doi:10.1016/j.bbagen.2016.08.017 909 Liang, G. (2022). Iron uptake, signaling, and sensing in plants. _Plant Communications, 3_ (5), 910 100349. doi:10.1016/j.xplc.2022.100349 911 Liang, G., Zhang, H. M., Li, X. L., Ai, Q., & Yu, D. Q. (2017). bHLH transcription factor bHLH115 912 regulates iron homeostasis in Arabidopsis thaliana. _Journal of Experimental Botany,_ 913 _68_ (7), 1743-1755. doi:10.1093/jxb/erx043 914 Liang, X. Q., Li, Y. M., Yao, A. Q., Liu, W. D., Yang, T. Y., Zhao, M. F., Zhang, B. X., & Han, D. G. 915 (2022). Overexpression of MxbHLH18 Increased Iron and High Salinity Stress Tolerance 916 in Arabidopsis thaliana. _International Journal of Molecular Sciences, 23_ (14), 8007. 917 doi:doi:10.3390/ijms23148007 918 Liu, B., Seong, K., Pang, S., Song, J., Gao, H., Wang, C., Zhai, J., Zhang, Y., Gao, S., Li, X., Qi, T., & 919 Song, S. (2021a). Functional specificity, diversity, and redundancy of Arabidopsis JAZ 920 family repressors in jasmonate and COI1-regulated growth, development, and defense. 921 _New Phytol, 231_ (4), 1525-1545. doi:10.1111/nph.17477 922 Liu, L., Xiang, Y., Yan, J. W., Di, P. C., Li, J., Sun, X. J., Han, G. Q., Ni, L., Jiang, M. Y., Yuan, J. H., & 923 Zhang, A. Y. (2021b). BRASSINOSTEROID-SIGNALING KINASE 1 phosphorylating 924 CALCIUM/CALMODULIN-DEPENDENT PROTEIN KINASE functions in drought tolerance 925 in maize. _New Phytologist, 231_ (2), 695-712. doi:10.1111/nph.17403 926 Liu, W., Li, R. J., Han, T. T., Cai, W., Fu, Z. W., & Lu, Y. T. (2015). Salt stress reduces root meristem 927 size by nitric oxide-mediated modulation of auxin accumulation and signaling in 928 Arabidopsis. _Plant Physiol, 168_ (1), 343-356. doi:10.1104/pp.15.00030 929 Liu, X., Gao, L., Yun, Q., Wang, W., Liu, X., Tang, W., Sun, Y., & Shang, J. X. (2025). Protein tyrosine 930 phosphatase IBR5 positively affects salt stress response by modulating CAT2 activity. 931 _Plant Sci, 359_, 112615. doi:10.1016/j.plantsci.2025.112615 932 Ma, L., Li, J. G., Li, J. F., Huo, Y. D., Yang, Y. Q., Jiang, C. F., & Guo, Y. (2026). Plant salt-tolerance 933 mechanisms: Classic signaling pathways, emerging frontiers, and future perspectives. 934 _Molecular Plant, 19_ (3), 538-570. doi:10.1016/j.molp.2025.12.009 935 Ma, L., Qin, D. B., Sun, L. P., Zhang, K. A., Yu, X., Dang, A. K., Hou, S. F., Zhao, X. Y., Yang, Y. Q., 936 Wang, Y., Chen, Y. H., & Guo, Y. (2025). SALT OVERLY SENSITIVE2 and AMMONIUM 937 TRANSPORTER1;1 contribute to plant salt tolerance by maintaining ammonium uptake. 938 _Plant Cell, 37_ (2). doi:10.1093/plcell/koaf034 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 939 Mhamdi, A., Noctor, G., & Baker, A. (2012). Plant catalases: peroxisomal redox guardians. _Arch_ 940 _Biochem Biophys, 525_ (2), 181-194. doi:10.1016/j.abb.2012.04.015 941 Mhamdi, A., Queval, G., Chaouch, S., Vanderauwera, S., Van Breusegem, F., & Noctor, G. (2010). 942 Catalase function in plants: a focus on Arabidopsis mutants as stress-mimic models. _J_ 943 _Exp Bot, 61_ (15), 4197-4220. doi:10.1093/jxb/erq282 944 Miller, G., Suzuki, N., Ciftci-Yilmaz, S., & Mittler, R. (2010). Reactive oxygen species homeostasis 945 and signalling during drought and salinity stresses. _Plant Cell and Environment, 33_ (4), 946 453-467. doi:10.1111/j.1365-3040.2009.02041.x 947 Minami, A., Onda, Y., Shimizu, M., Uehara-Yamaguchi, Y., Kanatani, A., Nakayama, R., Toyama, K., 948 Takahagi, K., Inoue, K., Nozoye, T., Suzuki, M., Kouzai, Y., Nomura, T., Tanoi, K., Endo, M., 949 Miki, R., Kashihara, M., Taoka, N., & Mochida, K. (2025). Chelation-based iron uptake 950 mitigates the effects of prolonged high-temperature stress in cool-season grasses. _Nat_ 951 _Commun, 16_ (1), 7709. doi:10.1038/s41467-025-63005-0 952 Mittler, R., Zandalinas, S. I., Fichman, Y., & Van Breusegem, F. (2022). Reactive oxygen species 953 signalling in plant stress responses. _Nature Reviews Molecular Cell Biology, 23_ (10), 663 954 679. doi:10.1038/s41580-022-00499-2 955 Motte, H., Vanneste, S., & Beeckman, T. (2019). Molecular and Environmental Regulation of Root 956 Development. _Annu Rev Plant Biol, 70_, 465-488. doi:10.1146/annurev-arplant-050718 957 100423 958 Panter, P. E., Kent, O., Dale, M., Smith, S. J., Skipsey, M., Thorlby, G., Cummins, I., Ramsay, N., 959 Begum, R. A., Sanhueza, D., Fry, S. C., Knight, M. R., & Knight, H. (2019). MUR1-mediated 960 cell-wall fucosylation is required for freezing tolerance in Arabidopsis thaliana. _New_ 961 _Phytologist, 224_ (4), 1518-1531. doi:10.1111/nph.16209 962 Rodríguez-Celma, J., Connorton, J. M., Kruse, I., Green, R. T., Franceschetti, M., Chen, Y. T., Cui, Y., 963 Ling, H. Q., Yeh, K. C., & Balk, J. (2019). Arabidopsis BRUTUS-LIKE E3 ligases negatively 964 regulate iron uptake by targeting transcription factor FIT for recycling. _Proceedings of_ 965 _the National Academy of Sciences of the United States of America, 116_ (35), 17584 966 17591. doi:10.1073/pnas.1907971116 967 Selote, D., Samira, R., Matthiadis, A., Gillikin, J. W., & Long, T. A. (2015). Iron-Binding E3 Ligase 968 Mediates Iron Response in Plants by Targeting Basic Helix-Loop-Helix Transcription 969 Factors. _Plant Physiology, 167_ (1), 273–286. doi:10.1104/pp.114.250837 970 Shen, L., Xia, X., Zhang, L., Yang, S., & Yang, X. (2023). Genome-Wide Identification of Catalase 971 Gene Family and the Function of SmCAT4 in Eggplant Response to Salt Stress. _Int J Mol_ 972 _Sci, 24_ (23). doi:10.3390/ijms242316979 973 Sherp, A. M., Westfall, C. S., Alvarez, S., & Jez, J. M. (2018). Arabidopsis thaliana GH3.15 acyl acid 974 amido synthetase has a highly specific substrate preference for the auxin precursor 975 indole-3-butyric acid. _J Biol Chem, 293_ (12), 4277-4288. doi:10.1074/jbc.RA118.002006 976 Song, R. F., Li, T. T., & Liu, W. C. (2021). Jasmonic Acid Impairs Arabidopsis Seedling Salt Stress 977 Tolerance Through MYC2-Mediated Repression of CAT2 Expression. _Frontiers in Plant_ 978 _Science, 12_ . doi:10.3389/fpls.2021.730228 979 Su, T., Wang, P., Li, H., Zhao, Y., Lu, Y., Dai, P., Ren, T., Wang, X., Li, X., Shao, Q., Zhao, D., Zhao, 980 Y., & Ma, C. (2018). The Arabidopsis catalase triple mutant reveals important roles of [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 981 catalases and peroxisome-derived signaling in plant development. _J Integr Plant Biol,_ 982 _60_ (7), 591-607. doi:10.1111/jipb.12649 983 Tsukagoshi, H. (2016). Control of root growth and development by reactive oxygen species. 984 _Current Opinion in Plant Biology, 29_, 57-63. doi:DOI 10.1016/j.pbi.2015.10.012 985 Tsukagoshi, H., Busch, W., & Benfey, P. N. (2010). Transcriptional Regulation of ROS Controls 986 Transition from Proliferation to Differentiation in the Root. _Cell, 143_ (4), 606-616. 987 doi:10.1016/j.cell.2010.10.020 988 van Zelm, E., Zhang, Y. X., & Testerink, C. (2020). Salt Tolerance Mechanisms of Plants. _Annual_ 989 _Review of Plant Biology, Vol 71, 2020, 71_, 403-433. doi:10.1146/annurev-arplant 990 050718-100005 991 Wang, N., Cui, Y., Liu, Y., Fan, H. J., Du, J., Huang, Z. A., Yuan, Y. X., Wu, H. L., & Ling, H. Q. (2013). 992 Requirement and functional redundancy of Ib subgroup bHLH proteins for iron 993 deficiency responses and uptake in Arabidopsis thaliana. _Molecular Plant, 6_ (2), 503-513. 994 doi:10.1093/mp/sss089 995 Wang, R. N., Lan, P., & Li, W. F. (2024). IMA peptides are dwarf giants fighting for fitness. _Trends_ 996 _in Plant Science, 29_ (8), 831-833. doi:10.1016/j.tplants.2024.03.016 997 Xie, Y. J., Xu, S., Han, B., Wu, M. Z., Yuan, X. X., Han, Y., Gu, Q. A., Xu, D. K., Yang, Q., & Shen, W. 998 B. (2011). Evidence of Arabidopsis salt acclimation induced by up-regulation of HY1 and 999 the regulatory role of RbohD-derived reactive oxygen species synthesis. _Plant Journal,_ 1000 _66_ (2), 280-292. doi:10.1111/j.1365-313X.2011.04488.x 1001 Xue, C. W., Li, W. F., Shen, R. F., & Lan, P. (2021). PERK13 modulates phosphate deficiency 1002 induced root hair elongation in Arabidopsis. _Plant Science, 312_ . 1003 doi:10.1016/j.plantsci.2021.111060 1004 Yan, P., Du, Q., Chen, H., Guo, Z., Wang, Z., Tang, J., & Li, W. X. (2023). Biofortification of iron 1005 content by regulating a NAC transcription factor in maize. _Science, 382_ (6675), 1159 1006 1165. doi:10.1126/science.adf3256 1007 Yang, Y. Q., & Guo, Y. (2018). Elucidating the molecular mechanisms mediating plant salt-stress 1008 responses. _New Phytologist, 217_ (2), 523-539. doi:10.1111/nph.14920 1009 Yuan, Y. X., Wu, H. L., Wang, N., Li, J., Zhao, W. N., Du, J., Wang, D. W., & Ling, H. Q. (2008). FIT 1010 interacts with AtbHLH38 and AtbHLH39 in regulating iron uptake gene expression for 1011 iron homeostasis in Arabidopsis. _Cell Research, 18_ (3), 385-397. doi:10.1038/cr.2008.26 1012 Zhang, J., Liu, B., Li, M. S., Feng, D. R., Jin, H. L., Wang, P., Liu, J., Xiong, F., Wang, J. F., & Wang, H. 1013 B. (2015). The bHLH transcription factor bHLH104 interacts with IAA-LEUCINE 1014 RESISTANT3 and modulates iron homeostasis in Arabidopsis. _Plant Cell, 27_ (3), 787-805. 1015 doi:10.1105/tpc.114.132704 1016 Zhang, Y., Liu, S., Liang, X., Zheng, J., Lu, X., Zhao, J., Li, H., Zhan, Y., Teng, W., Li, H., Han, Y., 1017 Zhao, X., & Li, Y. (2025). GmFER1, a soybean ferritin, enhances tolerance to salt stress 1018 and root rot disease and improves soybean yield. _Plant Biotechnology Journal, 23_ (8), 1019 3094-3112. doi:10.1111/pbi.70102 1020 Zhang, Y., Wang, L. F., Li, T. T., & Liu, W. C. (2021). Mutual Promotion of LAP2 and CAT2 1021 Synergistically Regulates Plant Salt and Osmotic Stress Tolerance. _Front Plant Sci, 12_, 1022 672672. doi:10.3389/fpls.2021.672672 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1023 Zhao, X. B., Wang, Q., Yan, C. X., Sun, Q. X., Wang, J., Li, C. J., Yuan, C. L., Mou, Y. F., & Shan, S. H. 1024 (2024). The bHLH transcription factor AhbHLH121 improves salt tolerance in peanut. 1025 _International Journal of Biological Macromolecules, 256_ . 1026 doi:10.1016/j.ijbiomac.2023.128492 1027 Zhou, H. P., Shi, H. F., Yang, Y. Q., Feng, X. X., Chen, X., Xiao, F., Lin, H. H., & Guo, Y. (2024). 1028 Insights into plant salt stress signaling and tolerance. _Journal of Genetics and Genomics,_ 1029 _51_ (1), 16-34. doi:10.1016/j.jgg.2023.08.007 1030 Zhou, P. J., Liu, C. F., Pan, Y. L., Fei, Y. C., Shen, R. F., Wang, R. N., & Lan, P. (2026). The conserved 1031 function of bHLH121 and overexpression of N-terminal bHLH121 fragment suppresses 1032 iron deficiency response in Arabidopsis. _bioRxiv_, 2026.2009.2027.754851. 1033 doi:10.64898/2026.09.27.754851 1034 Zhu, J. K. (2002). Salt and drought stress signal transduction in plants. _Annual Review of Plant_ 1035 _Biology, 53_, 247-273. doi:10.1146/annurev.arplant.53.091401.143329 1036 Zhuang, Y. F., Zhang, Y. Y., Shi, H. F., Pang, Y. N., Feng, X. X., Fan, W. J., Chang, D., Lin, H. H., & 1037 Zhou, H. P. (2025). CALMODULIN-BINDING RECEPTOR-LIKE CYTOPLASMIC KINASE 3 1038 regulates salt tolerance through CATALASE 2 in Arabidopsis. _Plant Physiology, 197_ (1). 1039 doi:10.1093/plphys/kiae669 1040 Zou, J. J., Li, X. D., Ratnasekera, D., Wang, C., Liu, W. X., Song, L. F., Zhang, W. Z., & Wu, W. H. 1041 (2015). Arabidopsis CALCIUM-DEPENDENT PROTEIN KINASE8 and CATALASE3 Function 1042 in Abscisic Acid-Mediated Signaling and H2O2 Homeostasis in Stomatal Guard Cells 1043 under Drought Stress. _Plant Cell, 27_ (5), 1445-1460. doi:10.1105/tpc.15.00144 1044 # 1045 Figure legends 1046 1047 **Figure 1. The** _**bhlh121**_ **mutant is hypersensitive to salt stress.** 1048 (A) Phenotypes of the _bhlh121-7_ mutant and three _bHLH121_ overexpression lines 1049 grown on ES medium supplemented with 0, 75, 100, or 150 mM NaCl for 10 days. 1050 Scale bars, 1 cm. (B) Relative root length. (C) Relative fresh weight. (D, E) Proline 1051 contents. (F, G) Malondialdehyde (MDA) contents. (H, I) Electrolyte leakage. (J–M) 1052 Na⁺ and K⁺ contents. (N, O) Na⁺/K⁺ ratios. Data are presented as means ± SD; sample 1053 sizes are indicated by circles. Different letters indicate significant differences according 1054 to one-way ANOVA followed by Tukey’s multiple comparison test ( _P_ < 0.05); 1055 asterisks indicate significant differences from WT according to Student’s t-test (* _P_ < 1056 0.05, ** _P_ < 0.01, *** _P_ < 0.001, **** _P_ < 0.0001). 1057 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1058 **Figure 2.** _**bHLH121**_ **and** _**SOS2**_ **act additively in response to salt stress.** 1059 (A) Phenotypes of WT, the _bhlh121-7_ mutant, the _sos2-T1_ mutant, and the _bhlh121-7_ 1060 _sos2-T1_ double mutant grown on ES medium for 5 d and then transferred to ES medium 1061 supplemented with 25 mM NaCl or 0 μM Fe for 7 d. Scale bars, 1 cm. (B) Relative root 1062 length. (C) Relative fresh weight. (D) Chlorophyll content. (E–G) Relative expression 1063 levels of _SOS1_ (E), _IRT1_ (F), and _FRO2_ (G). Seedlings grown on ES medium for 5 d 1064 were transferred to medium supplemented with 25 mM NaCl or 0 μM Fe for 7 d, and 1065 root samples were collected for qRT-PCR analysis. Data are presented as means ± SD; 1066 sample sizes are indicated by circles. Statistical differences were analyzed by one-way 1067 ANOVA followed by Tukey’s multiple comparison test. Different letters indicate 1068 significant differences ( _P_ < 0.05). 1069 1070 **Figure 3. Application of ROS scavengers KI and GSH restores the root growth of** 1071 **the** _**bhlh121-7**_ **mutant under salt stress.** 1072 (A) Phenotype of the _bhlh121-7_ mutant grown on ES medium supplemented with 1073 reactive oxygen species (ROS) scavengers KI (500 μM) or GSH (200 μM) under salt 1074 stress for 10 d. Scale bars, 1 cm. (B, C) Relative root length. (D) ROS detection by NBT 1075 (O 2 [•–] ) and DAB staining (H 2 O 2 ). Data are presented as means ± SD; sample sizes are 1076 indicated by circles. Statistical differences were analyzed using one-way ANOVA 1077 followed by Tukey’s multiple comparisons test. Different letters indicate significant 1078 differences ( _P_ < 0.05). 1079 1080 **Figure 4. Sharp ROS accumulation in the root tips of the** _**bhlh121-7**_ **mutant under** 1081 **short-term salt stress.** 1082 (A–C) Accumulation and quantification of NBT staining (O 2 [•–] ) of WT, _bhlh121-7_, and 1083 three independent _bHLH121_ -complemented transgenic lines. (D–F) Accumulation and 1084 quantification of DAB staining (H 2 O 2 ) of WT, _bhlh121-7_, and three _bHLH121_ 1085 complemented transgenic lines. Seedlings grown on ES medium for 7 d were [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1086 transferred to liquid ES medium supplemented with or without 100 mM NaCl and 1087 treated for 6 h before staining and observation. Staining was quantified using gray 1088 values of linear ROIs extending 2 mm along the longitudinal axis from the root tip. 1089 Scale bars, 1 mm. 1090 1091 **Figure 5. bHLH121 is critical for ROS-dependent regulation of root apical** 1092 **meristem (RAM) size under salt stress.** 1093 (A, B) Confocal microscopy images of the RAM in WT and the _bhlh121-7_ mutant under 1094 control conditions (A) and salt stress (B). Roots of 10-day-old seedlings grown on 1095 medium with or without the ROS scavengers KI and GSH were stained with propidium 1096 iodide (PI) and observed. Scale bars, 100 μm. White triangles indicate the boundaries 1097 of the meristematic zone. (C, D) Quantification of RAM length in control (C) and NaCl 1098 treated (D) seedlings. (E, F) Quantification of RAM cell number in control (E) and 1099 NaCl-treated (F) seedlings. (G, H) Relative expression levels of _PLT1_ (G) and _PLT2_ 1100 (H). Data are presented as means ± SD; sample sizes are indicated by circles. Different 1101 letters indicate significant differences according to one-way ANOVA followed by 1102 Tukey’s multiple comparison test ( _P_ < 0.05); asterisks indicate significant differences 1103 from WT according to Student’s t-test (* _P_ < 0.05, ** _P_ < 0.01, *** _P_ < 0.001). 1104 1105 **Figure 6. Transcriptome analysis indicates enhanced ROS biosynthesis and** 1106 **impaired H** **2** **O** **2** **scavenging capacity of salt-stressed** _**bhlh121**_ **plants.** 1107 (A, B) Venn diagram analysis of salt-upregulated (A) and down-regulated (B) genes 1108 between WT and _bhlh121-7_ . (C–F) Representative selection of enriched gene ontology 1109 (GO) terms among differentially expressed genes (DEGs) that are specifically up- or 1110 downregulated upon salt stress in WT (C, D) and _bhlh121-7_ mutant (E, F). (G–I) 1111 Relative expression of _RBOHD_ (G), _PRX8_ (H), and _CAT2_ (I). Seedlings were 1112 germinated and grown for 10 d in control and NaCl (100 mM) agar plates. Root samples 1113 were collected and subjected to mRNA-Seq and qRT-PCR. Data are presented as means [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1114 ± SD (n = 3). Asterisks indicate significant differences from WT according to Student’s 1115 t-test (* _P_ < 0.05, ** _P_ < 0.01, **** _P_ < 0.0001). 1116 1117 **Figure 7. Overexpression of** _**CAT2**_ **rescues the salt sensitivity of the** _**bhlh121**_ 1118 **mutant.** 1119 (A) EMSA showing that bHLH121 binds to the promoter of _CAT2_ . Biotin- _CAT2_, 1120 biotin-labeled probe; Cold- _CAT2_, unlabeled probe; Cold- _CAT2-m_, unlabeled probe 1121 with two mutated E-boxes. Biotin- _CAT2_ incubated with His-TF served as the negative 1122 control. (B) Phenotypes of 35S promoter-driven _CAT2_ overexpression transgenic lines 1123 in the _bhlh121-7_ background grown on ES medium supplemented with 100 mM NaCl 1124 or on low-iron medium (0 μM Fe) for 10 d. Scale bars, 1 cm. (C) Relative expression 1125 of _CAT2_ . Root of 10-d-old seedlings cultured on ES medium were harvested for qRT 1126 PCR. (D) Relative root length. (E) Relative fresh weight. (F) Chlorophyll content. Data 1127 are presented as means ± SD; sample sizes are indicated by circles. Statistical 1128 differences were analyzed using one-way ANOVA followed by Tukey’s multiple 1129 comparisons test. Different letters indicate significant differences ( _P_ < 0.05). Asterisks 1130 indicate significant differences from the WT according to Student’s t-test (* _P_ < 0.05, 1131 **** _P_ < 0.0001). 1132 1133 **Figure 8. Overexpression of** _**CAT2**_ **increases the CAT activity of the** _**bhlh121**_ 1134 **mutant.** 1135 (A) H 2 O 2 content. (B) CAT activity. (C) POD activity. (D) SOD activity. Seedlings 1136 grown on ES medium for 7 d were transferred to salt stress (100 mM NaCl) for 7 d, 1137 after which root samples were collected for measurement. Data are presented as means 1138 ± SD; sample sizes are indicated by circles. Asterisks indicate significant differences 1139 from the WT according to Student’s t-test (* _P_ < 0.05, *** _P_ < 0.001). 1140 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1141 **Figure 9. Overexpression of** _**CAT2**_ **rescues the ROS balance in the root tips of the** 1142 _**bhlh121**_ **mutant under salt stress.** 1143 (A−C) Accumulation and quantification of NBT staining (O 2 [•−] ) in WT, _bhlh121-7_, and 1144 three _35S::CAT2_ / _bhlh121_ transgenic lines. (D−F) Accumulation and quantification of 1145 DAB staining (H 2 O 2 ) of WT, _bhlh121-7_, and three _35S::CAT2_ / _bhlh121_ transgenic lines. 1146 Seedlings grown on ES medium for 7 d were transferred to liquid ES medium 1147 supplemented with or without 100 mM NaCl and treated for 6 h before staining and 1148 observation. Staining was quantified using gray values of linear ROIs extending 2 mm 1149 along the longitudinal axis from the root tip. Scale bars, 1 mm. 1150 1151 **Figure 10. Exogenous application of DIECA and IAA rescues the inhibition of root** 1152 **elongation in the** _**bhlh121-7**_ **mutant under salt stress.** 1153 (A−C) Seedlings were grown on medium supplemented with jasmonic acid inhibitor 1154 DIECA for 10 d (A). Scale bars, 1 cm. Primary root lengths of seedlings from control 1155 (B) and NaCl (C) groups were measured. (D−F) Seedlings were grown on medium 1156 supplemented with the auxin IAA for 10 d (D). Scale bars, 1 cm. Primary root lengths 1157 of seedlings from the control (E) and NaCl (F) groups were measured. (G-I) Relative 1158 expression of _JAZ1_, _JAZ10_ and _GH3.15_ . Data are presented as means ± SD; sample 1159 sizes are indicated by circles. Different letters indicate significant differences according 1160 to one-way ANOVA followed by Tukey’s multiple comparisons test ( _P_ < 0.05); 1161 asterisks indicate significant differences from the WT according to Student’s t-test 1162 (*** _P_ < 0.001, **** _P_ < 0.0001). 1163 1164 **Figure 11. Overexpression of** _**bHLH121**_ **homologous genes rescues the salt** 1165 **sensitivity of the** _**bhlh121**_ **mutant.** 1166 (A) Phenotypes of 35S promoter-driven _Populus_ _PtbHLH121_, soybean _GsbHLH121_, 1167 Citrus _CcbHLH121_, and Cucumber _CsbHLH121_ overexpression transgenic lines in the 1168 _bhlh121-7_ background grown on ES medium supplemented with 100 mM NaCl for 10 [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) 1169 d. Scale bars, 1 cm. (B–E) Relative root lengths. Data are presented as means ± SD; 1170 sample sizes are indicated by circles. Statistical differences were analyzed using one 1171 way ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate 1172 significant differences ( _P_ < 0.05). **A** **B** _35S::bHLH121_ /WT WT #15 #6 #41 |a a a<br>a<br>b|a a<br>b|Col3|Col4|a a<br>a a a a<br>b|Control<br>75mMNaCl<br>100mMNaCl<br>150mMNaCl<br>a b a a a| |---|---|---|---|---|---| |a<br>b<br>a<br>a<br>a|a<br>b<br>a||||| **40** **38** **38** **39** **28** **40** **34** **39** **40** **39** **38** **39** **24** **36** **33** ~~**31**~~ ~~**33**~~ **20** ~~**31**~~ **38** **C** 125 100 75 50 25 0 125 100 75 50 25 0 a |a<br>a<br>a a|a<br>a<br>b|Col3|Col4|ab ab<br>a a<br>ab ab<br>b|Control<br>75mMNaCl<br>100mMNaCl<br>150mMNaCl<br>a a a a<br>b| |---|---|---|---|---|---| |a<br><br>a<br>a<br>a|a<br>b<br>a<br>||||| **D** **E** **F** **G** Shoot_Pro Root_Pro Shoot_MDA Root_Pro Shoot_MDA Root_MDA 30 20 10 WT 400 300 200 100 20 15 10 5 400 300 200 100 0 0 Control NaCl 0 Control NaCl **H** **I** **J** **K** [+] 0 Control NaCl Root_Na [+] Shoot_EL Root_EL Shoot_Na [+] 150 100 50 80 60 40 20 40 30 20 10 60 40 20 0 |Control NaCl WT bhlh121-7 *** Shoot_EL|Col2| |---|---| |**<br>***|**<br>***| |**<br>***|| ||| Control NaCl 0 Control NaCl 0 Control NaCl 0 Control NaCl **L** **M** **N** [+] [+] **O** Shoot_K [+] Root_K [+] Shoot_Na [+] /K [+] Root_K [+] Shoot_Na /K Root_Na [+] /K [+] 150 100 50 4 150 100 50 0.8 0.6 0.4 0.2 0.0 Control NaCl 0 Control NaCl 0 Control NaCl 3 2 1 0 Control NaCl **Fig. 1 The** _**bhlh121**_ **mutant is hypersensitive to salt stress.** (A) Phenotypes of the _bhlh121-7_ mutant and three _bHLH121_ overexpression lines grown on ES medium supplemented with 0, 75, 100, or 150 mM NaCl for 10 days. Scale bars, 1 cm. (B) Relative root length. (C) Relative fresh weight. (D, E) Proline contents. (F, G) Malondialdehyde (MDA) contents. (H, I) Electrolyte leakage. (J-M) Na ⁺ and K ⁺ contents. (N, O) Na ⁺ /K ⁺ ratios. Data are presented as means ± SD; sample sizes are indicated by circles. Different letters indicate significant differences by one-way ANOVA followed by Tukey’s multiple comparison test ( _P_ < 0.05); asterisks indicate significant differences from WT based on Student’s t-test (* _P_ < 0.05, ** _P_ < 0.01, *** _P_ < 0.001, **** _P_ < 0.0001). **A** **B** **C** 150 125 100 75 50 25 0 _SOS1_ _FRO2_ |Col1|Col2|Col3| |---|---|---| |||| |||| **D** **E** 1.0 0.8 0.6 0.4 0.2 Control 25 mM NaCl 0 μM Fe 0.0 **F** **G** 175 150 125 100 75 50 25 0 6 5 4 3 2 1 0 12 10 8 6 4 2 0 15 12 9 6 3 0 _IRT1_ **Fig. 2** _**bHLH121**_ **and** _**SOS2**_ **act additively in response to salt stress.** (A) Phenotypes of WT, the _bhlh121-7_ mutant, the _sos2-T1_ mutant, and the _bhlh121-7 sos2-T1_ double mutant grown on ES medium for 5 d and then transferred to ES medium supplemented with 25 mM NaCl or 0 μM Fe for 7 d. Scale bars, 1 cm. (B) Relative root length. (C) Relative fresh weight. (D) Chlorophyll content. (E–G) Relative expression levels of _SOS1_ (E), _IRT1_ (F), and _FRO2_ (G). Seedlings grown on ES medium for 5 d were transferred to medium supplemented with 25 mM NaCl or 0 μM Fe for 7 d, and root samples were collected for qRT-PCR analysis. Data are presented as means ± SD; sample sizes are indicated by circles. Statistical differences were analyzed by one-way ANOVA followed by Tukey’s multiple comparison test. Different letters indicate significant differences ( _P_ < 0.05). **A** **B** **C** Control Control+KI Control+GSH 125 100 75 50 25 WT _bhlh121-7_ NaCl NaCl+KI NaCl+GSH 50 40 30 20 10 KI GSH **D** - + - - + WT _bhlh121-7_ NBT staining DAB staining WT _bhlh121-7_ WT _bhlh121-7_ KI - + + + + + + + GSH + **Fig. 3 Application of ROS scavengers KI and GSH restores the root growth** **of the** _**bhlh121-7**_ **mutant under salt stress.** (A) Phenotype of the _bhlh121-7_ mutant grown on ES medium supplemented with reactive oxygen species (ROS) scavengers KI (500 μM) or GSH (200 μM) under salt stress for 10 days. Scale bars, 1 cm. (B, C) Relative root length. (D) ROS detection by NBT (O 2•– ) and DAB staining (H 2 O 2 ). Data are presented as means ± SD; sample sizes are indicated by circles. The statistical differences were analyzed using a one-way ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate significant differences ( _P_ < 0.05). **A** **B** _gbHLH121/bhlh121-7_ WT #23 #30 #34 #23 #30 #34 **300** **200** **100** WT _bhlh121-7_ **0** **0.0** **0.5** **1.0** **1.5** **2.0** **C** **300** **200** **100** **Distance from root tip (mm)** NBT staining **D** **E** _gbHLH121/bhlh121-7_ **0** **0.0** **0.5** **1.0** **1.5** **2.0** **Distance from root tip (mm)** #23 #30 #34 WT #23 #30 #34 DAB staining **250** **200** **150** **100** **50** WT _bhlh121-7_ **0** **0.0** **0.5** **1.0** **1.5** **2.0** **F** **300** **200** **100** **Distance from root tip (mm)** **0** **0.0** **0.5** **1.0** **1.5** **2.0** **Distance from root tip (mm)** **Fig. 4 Sharp ROS accumulation in the root tips of the** _**bhlh121-7**_ **mutant under** **short-term salt stress.** (A-C) Accumulation and quantification of NBT staining (O 2•– ) of WT, _bhlh121-7_, and three independent _bHLH121_ -complemented transgenic lines. (D-F) Accumulation and quantification of DAB staining (H 2 O 2 ) of WT, _bhlh121-7_, and three _bHLH121_ -complemented transgenic lines. Seedlings grown on ES medium for 7 d were transferred to liquid ES medium supplemented with or without 100 mM NaCl and treated for 6 h before staining and observation. Staining was quantified using gray values of linear ROIs extending 2 mm along the longitudinal axis from the root tip. Scale bars, 1 mm. **A** Control Control+ KI Control+ GSH **B** NaCl NaCl+KI NaCl+GSH **C** **D** **G** _PLT1_ 125 100 75 50 25 125 100 3 2 1 75 50 25 0 WT _bhlh121-7_ **E** **F** 0 WT _bhlh121-7_ 0 Control NaCl _PLT2_ 5 4 3 2 1 125 100 75 50 25 125 100 75 50 25 Control Control+KI Control+GSH **H** 0 WT _bhlh121-7_ 0 WT _bhlh121-7_ 0 Control NaCl **Fig. 5 bHLH121 is critical for ROS-dependent regulation of root apical meristem (RAM)** **size under salt stress.** (A, B) Confocal microscopy images of the RAM in WT and _bhlh121-7_ mutant under control (A) and salt stress (B) treatment. Root of 10-day-old seedlings grown on medium supplemented without or with the ROS scavengers KI and GSH were observed following propidium iodide (PI) staining. Scale = 100 μm. White triangles denote the start and end points of the meristematic zone. (C, D) Determination of RAM length of seedlings from control (C) and NaCl (D) groups. (E, F) Statistics of RAM cell number of seedlings from control (E) and NaCl (F) groups. (G, H) Relative expression of _PLT1_ and _PLT2_ . Data are presented as means ± sd (sample size is indicated by circles). Different letters indicate significant differences for a one-way ANOVA followed by Tukey’s multiple comparisons test ( _P_ < 0.05); asterisks indicate significant differences from the WT for Student’s t-test (* _P_ < 0.05, ** _P_ < 0.01, *** _P_ < 0.001). **A** **B** NaCl_vs_ES_WT_up NaCl_vs_ES_ _bhlh121_ _up NaCl_vs_ES_WT_down NaCl_vs_ES_ _bhlh121_ _down **C** **E** WT_up_201genes _bhlh121_ _up_341genes **D** WT_down_205genes **F** _bhlh121_ _down_553genes **G** _RBOHD_ **H** _PRX8_ **I** _CAT2_ 2.0 1.5 1.0 0.5 WT 8 6 4 2 1.5 1.0 0.5 0.0 |Col1|WT *| |---|---| ||_bhlh121-7_| ||| ||| Control NaCl 0 Control NaCl 0.0 |Col1|CAT2 WT bhlh121-7| |---|---| ||_bhlh121-7_<br>**| ||| ||| Control NaCl **Fig. 6 Transcriptome analysis indicates enhanced ROS biosynthesis and impaired** **H** **2** **O** **2** **scavenging capacity of salt-stressed** _**bhlh121**_ **plants.** (A, B) Venn diagram analysis of salt-upregulated (A) and down-regulated (B) genes between WT and _bhlh121-7_ . (C-F) Representative selection of enriched gene ontology (GO) terms among differentially expressed genes (DEGs) that are specifically up- or downregulated upon salt stress in WT (C, D) and _bhlh121-7_ mutant (E, F). (G-I) Relative expression of _RBOHD_ (G), _PRX8_ (H), and _CAT2_ (I). Seedlings were germinated and grown for 10 d in control and NaCl (100 mM) agar plates. Root samples were collected and subjected to mRNA-Seq and qRT-PCR. Data are presented as means ± SD (n = 3). Asterisks indicate significant differences from the WT for Student’s t-test (* _P_ < 0.05, ** _P_ < 0.01, **** _P_ < 0.0001). **A** **B** His-TF-bHLH121 His-TF Biotin- _CAT2_ Cold- _CAT2_ Cold- _CAT2-m_ protein-DNA free probe WT - + + + + - - + + + + - - 100× - - - 100× _35S::CAT2/bhlh121-7_ #1 #2 #7 **D** **E** **F** 5 4 3 2 1 0 **C** 140 120 100 80 60 40 20 0 140 120 100 80 60 40 20 0 0.9 0.8 0.7 0.6 0.5 0.4 0.3 0.2 0.1 0.0 |Col1|Col2|Col3|Col4|Col5| |---|---|---|---|---| |||||| |Col1|Col2| |---|---| ||| **Fig. 7 Overexpression of** _**CAT2**_ **rescues the salt sensitivity of the** _**bhlh121**_ **mutant.** (A) EMSA showing that bHLH121 binds to the promoter of _CAT2_ . Biotin- _CAT2_, biotin-labeled probe; Cold- _CAT2_, unlabeled probe; Cold- _CAT2-m_, unlabeled probe with a mutated E-box. Biotin- _CAT2_ incubated with His-TF served as the negative control. (B) Phenotypes of 35S promoter-driven _CAT2_ overexpression transgenic lines in the _bhlh121-7_ background grown on ES medium supplemented with 100 mM NaCl or on low-iron medium (0 μM Fe) for 10 d. Scale bars, 1 cm. (C) Relative expression of _CAT2_ . Root of 10-d-old seedlings cultured on ES medium were harvested for qRT-PCR. (D) Relative root length. (E) Relative fresh weight. (F) Chlorophyll content. Data are presented as means ± SD; sample size is indicated by circles. Statistical differences were analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate significant differences ( _P_ < 0.05). Asterisks indicate significant differences from the WT according to Student’s t-test (* _P_ < 0.05, **** _P_ < 0.0001). **A** **B** 0.5 0.4 0.3 0.2 0.1 0.0 |Col1|Control ns| |---|---| ||Control<br>100 mM NaCl<br>ns<br>ns| ||| ||| ||| **B** **D** 1000 800 600 400 200 0 2500 2000 1500 1000 500 0 |Col1|Col2|Col3|Col4|Col5| |---|---|---|---|---| ||*|*||| 15000 10000 5000 0 |Col1|Col2| |---|---| ||| **Fig. 8 Overexpression of** _**CAT2**_ **increases the CAT activity of the** _**bhlh121**_ **mutant.** (A) H 2 O 2 content. (B) CAT activity. (C) POD activity. (D) SOD activity. Seedlings grown on ES medium for 7 d were transferred to salt stress (100 mM NaCl) for 7 d, after which root samples were collected for measurement. Data are presented as means ± SD; sample size is indicated by circles. Asterisks indicate significant differences from the WT according to Student’s t-test (* _P_ < 0.05, *** _P_ < 0.001). **A** _35S::CAT2_ **B** _/bhlh121-7_ WT #1 #2 #7 NBT staining #1 #2 #7 **300** **200** **100** **0** |WT #|Col2|Col3|Col4| |---|---|---|---| |#<br>#<br><br>_bhlh121-7_<br>Control<br>|#<br>#<br><br>_bhlh121-7_<br>Control<br>|#<br>#<br><br>_bhlh121-7_<br>Control<br>|#<br>#<br><br>_bhlh121-7_<br>Control<br>| ||||| **0.0** **0.5** **1.0** **1.5** **2.0** **C** **250** **200** **150** **100** **50** **Distance from root tip (mm)** **0** |NaCl|Col2|Col3|Col4| |---|---|---|---| ||||| **0.0** **0.5** **1.0** **1.5** **2.0** **Distance from root tip (mm)** **D** _35S::CAT2_ **E** _/bhlh121-7_ _35S::CAT2_ _/bhlh121-7_ WT #1 #2 #7 DAB staining **220** **200** **180** **160** **140** **120** **100** |#2 #7 WT bhlh121-7 #1|Col2|Col3|Col4| |---|---|---|---| |Control<br>#7|Control<br>#7|Control<br>#7|Control<br>#7| ||||| **0.0** **0.5** **1.0** **1.5** **2.0** **F** **300** **200** **100** **Distance from root tip (mm)** **0** |NaCl|Col2|Col3|Col4| |---|---|---|---| ||||| **0.0** **0.5** **1.0** **1.5** **2.0** **Distance from root tip (mm)** **Fig. 9 Overexpression of** _**CAT2**_ **rescues the ROS balance in the root tips of the** _**bhlh121**_ **mutant under salt stress.** (A-C) Accumulation and quantification of NBT staining (O 2•– ) in WT, _bhlh121-7_, and three _35S::CAT2_ / _bhlh121_ transgenic lines. (D-F) Accumulation and quantification of DAB staining (H 2 O 2 ) of WT, _bhlh121-7_, and three _35S::CAT2_ / _bhlh121_ transgenic lines. Seedlings grown on ES medium for 7 d were transferred to liquid ES medium supplemented with or without 100 mM NaCl and treated for 6 h before staining and observation. Staining was quantified using gray values of linear ROIs extending 2 mm along the longitudinal axis from the root tip. Scale bars, 1 mm. **A** **D** DIECA(μM) 0 25 50 100 IAA(nM) 0 10 50 100 **B** **C** Control+50 DIECA Control+100 DIECA **E** **F** 125 100 75 50 25 Control Control+10 IAA 125 100 75 50 25 Control Control+25 DIECA Control+50 IAA Control+100 IAA 0 |a a<br>b bc b<br>c<br>d<br>24 24 23 24 20 24 22 24|Col2|Col3|Col4| |---|---|---|---| |**23**<br>**24**<br>**24**<br>**24**<br>**20**<br>**24**<br>**22**<br>**24**<br>a<br>a<br><br>c<br>b<br>bc<br>b<br>d|**20**<br>**2**|**4**<br>**22**|**4**<br>**22**| |**23**<br>**24**<br>**24**<br>**24**<br>**20**<br>**24**<br>**22**<br>**24**<br>a<br>a<br><br>c<br>b<br>bc<br>b<br>d|**20**<br>**2**|**4**<br>**22**|**24**| |24 23|Col2| |---|---| |**23**<br>**24**|**24**| WT _bhlh121-7_ 0 WT _bhlh121-7_ 60 50 40 30 20 10 NaCl NaCl+10 IAA 60 50 40 30 20 10 NaCl NaCl+25 DIECA NaCl+50 DIECA NaCl+100 DIECA NaCl+50 IAA NaCl+100 IAA 0 |7|Col2| |---|---| |**7**|**29**| WT _bhlh121-7_ 0 WT _bhlh121-7_ **G** _JAZ1_ **H** _JAZ10_ **I** _GH3.15_ 5 3 **** 25 **** _JAZ1_ _JAZ10_ 5 3 25 2 1 0 |bhlh121-7|Col2|Col3|Col4| |---|---|---|---| |_bhlh121-7_|||| Control NaCl 4 3 2 1 20 15 10 5 0 Control NaCl 0 |WT GH3.15|Col2|****| |---|---|---| |_bhlh121-7_|_bhlh121-7_|| |_bhlh121-7_||| Control NaCl **Fig. 10 Exogenous application of DIECA and IAA rescues the inhibition of root** **elongation in the** _**bhlh121-7**_ **mutant under salt stress.** (A-C) Seedlings were grown on medium supplemented with jasmonic acid inhibitor DIECA for 10 d (A). Scale bars, 1 cm. Primary root lengths of seedlings from control (B) and NaCl (C) groups were measured. (DF) Seedlings were grown on medium supplemented with the auxin IAA for 10 d (D). Scale bars, 1 cm. Primary root lengths of seedlings from the control (E) and NaCl (F) groups were measured. (G-I) Relative expression of _JAZ1_, _JAZ10_ and _GH3.15_ . Data are presented as means ± SD; sample size is indicated by circles. Different letters indicate significant differences according to one-way ANOVA followed by Tukey’s multiple comparisons test ( _P_ < 0.05); asterisks indicate significant differences from the WT according to Student’s t-test (*** _P_ < 0.001, **** _P_ < 0.0001). **A** _35S::CsbHLH121_ / _bhlh121-7_ _35S::PtbHLH121_ / _bhlh121-7_ WT #1 #27 #28 WT #13 #15 #6 WT #1 #9 #22 WT #8 #12 #30 _35S::GsbHLH121_ / _bhlh121-7_ _35S::CcbHLH121_ / _bhlh121-7_ **B** _35S::PtbHLH121_ / _bhlh121-7_ **C** _35S::GsbHLH121_ / _bhlh121-7_ 125 100 75 50 25 0 125 100 75 50 25 0 |a b c 35S::PtbHLH1|Col2|Col3|Col4|Col5|Col6|Col7|Col8|Col9|Col10|Col11|Control 121/bhlh121-7|Col13|Col14|Col15|Col16|Col17|Col18|Col19| |---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---| |**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b|Control<br>NaCl<br>**25**<br>**25**<br>**25**<br>**24**<br>**24**<br>a<br>c<br>a<br>b<br>b| |**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**|**24**|**24**|**24**|**24**|**24**|**21**|**21**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**| |**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**|**24**|**24**|**24**|**24**|**24**|**21**|**21**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**24**|**24**|**24**| |**24**<br>**24**<br>**24**<br>**21**<br>**25**<br>b<br>c<br>bc<br>c|**24**|**24**|**24**|**24**|**24**|**24**|**21**|**21**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**|**25**| |||||||||||||||||||| |Col1|ab a ab bc|Col3|Col4|Col5|Col6|Col7|Col8|Col9|Col10|Col11|Control| |---|---|---|---|---|---|---|---|---|---|---|---| ||a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|a<br>c<br>a<br>ab<br>c|Control<br>NaCl<br>**25**<br>**25**<br>**24**<br>**20**<br>**23**<br>a<br>c<br>a<br>b<br>ab| ||**24**|**24**|**24**||**24**|**24**|**23**|**23**|**23**|**23**|**23**| ||||||||||||| **D** _35S::CcbHLH121_ / _bhlh121-7_ **E** _35S::CsbHLH121_ / _bhlh121-7_ 125 100 75 50 25 0 125 100 75 50 25 0 **Fig. 11 Overexpression of** _**bHLH121**_ **homologous genes rescues the salt** **sensitivity of the** _**bhlh121**_ **mutant.** (A) Phenotypes of 35S promoter-driven _Populus_ _PtbHLH121_, soybean _GsbHLH121_, Citrus _CcbHLH121_, and Cucumber _CsbHLH121_ overexpression transgenic lines in the _bhlh121-7_ background grown on ES medium supplemented with 100 mM NaCl for 10 d. Scale bars, 1 cm. (B-E) Relative root lengths. Data are presented as means ± SD; sample size is indicated by circles. Statistical differences were analyzed using one-way ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate significant differences ( _P_ < 0.05). **A** Time of NaCl treatment **B** Time of NaCl treatment **C** **D** Shoot NaCl NaCl **Supplementary Fig. 1 Gene expression analysis of** _**bHLH121**_ **in Arabidopsis** **seedlings in response to salt stress.** Relative gene expression of _bHLH121_ was determined by RT-qPCR. (A, B) Arabidopsis Col-0 seedlings grown on ES medium for 10 d were transferred to ES medium with 200 mM NaCl for treatment. Shoots (A) and roots (B) samples were collected separately at indicated time points. (C, D) 10-day-old Col-0 seedlings were transferred to ES medium supplemented with varying concentrations of NaCl (75 mM, 100 mM, 150 mM, 200 mM) for treatment. After 12 h, shoots (C) and roots (D) samples were collected separately. _Tubulin_ _α-3_ was used as an internal reference control, and transcript levels were calculated using the 2 [-ΔΔCT] method. Data are means ± sd (n = 3 technical repeats). Statistical significance was determined according to Student’s t-test (* _P_ < 0.05, ** _P_ < 0.01, *** _P_ < 0.001, **** _P_ < 0.0001). **A** Control 75 mM NaCl 100 mM NaCl 150 mM NaCl **Supplementary Fig. 2 Both** _**bhlh121-7**_ **and** _**bhlh121-8**_ **mutants show** **hypersensitivity to salt stress.** (A) Phenotypes of WT, _bhlh121-7_, and _bhlh121-8_ plants grown on ES mediums supplemented with 0, 75, 100, 150 mM NaCl for 10 d. Scale = 1 cm. (B) Relative root length of WT, _bhlh121-7_, and _bhlh121-8_ mutants under control or salt stress conditions. Data are presented as means ± sd (sample size is indicated by circles). The statistical differences were analyzed using a oneway ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate significant differences ( _P_ < 0.05). **A** _gbHLH121/bhlh121-7_ **B** **C** WT #23 #30 #34 **Supplementary Fig. 3 The full-length** _**bHLH121**_ **gene rescues the salt** **hypersensitivity of the** _**bhlh121**_ **mutant.** (A) Phenotypes of the _bHLH121_ complementary transgenic lines grown on ES medium supplemented with 100 mM NaCl for 10 days. Scale = 1 cm. (B) Relative root length. (C) Relative fresh weight. Data are presented as means ± sd (sample size is indicated by circles). Different letters indicate significant differences for a one-way ANOVA followed by Tukey’s multiple comparisons test ( _P_ < 0.05). _gbHLH121/bhlh121-7_ _gbHLH121/bhlh121-7_ WT #23 #30 #34 WT #23 #30 #34 NBT staining DAB staining **Supplementary Fig. 4 The full-length** _**bHLH121**_ **gene rescues ROS** **imbalance in the** _**bhlh121-7**_ **mutant under salt stress.** Seedlings grown on ES medium supplemented with 100 mM NaCl for 10 days were sampled for ROS detection by NBT (O 2 - – ) and DAB staining (H 2 O 2 ). **A** **B** _bhlh121_ _vs_WT_up157DEGs _bhlh121_ _vs_WT_down50DEGs **C** _bhlh121_ _vs_WT_112/207DEGs **Supplementary Fig. 5 Gene Ontology (GO) and heatmap analysis of** **differentially expressed genes (DEGs) between WT and** _**bhlh121-7**_ **mutant.** (A) Top 10 GO terms of upregulated DEGs in _bhlh121_ mutant compared to WT. (B) Top 10 GO terms of downregulated DEGs in _bhlh121_ mutant compared to WT.(C) Heatmap results showing 112 representative genes out of 207 total DEGs between _bhlh121_ and WT roots. **A** WT_ _bhlh121_ _shared_up_176genes WT_ _bhlh121_ _shared_down_304genes **Supplementary Fig. 6 Gene Ontology (GO) enrichment analysis of shared** **differentially expressed genes (DEGs) in salt-stressed WT and** _**bhlh121-7**_ **roots.** (A) Top 15 GO terms of shared upregulated 176 DEGs in _bhlh121_ mutant and WT. (B) Top 15 GO terms of shared downregulated 304 DEGs in _bhlh121_ mutant and WT. **A** **B** WT _bhlh121_ WT _bhlh121_ **B** WT _bhlh121_ **Supplementary Fig. 7 Heatmap analysis of ROS related genes in WT and** _**bhlh121**_ **mutant under salt stress.** Two manually curated lists of _RBOH_ genes (A) and other genes in ROS homeostasis (B) were compared in WT and _bhlh121_ mutant. **A** WT _bhlh121_ **B** **Supplementary Fig. 8 Transcriptome analyses indicate the involvement of** **jasmonic acid (JA) signaling and auxin homeostasis in the salt-sensitive** **phenotype of the** _**bhlh121-7**_ **mutant.** (A) Heatmap analysis of the expression changes of JA pathway genes in WT and _bhlh121_ mutant under salt stress. (B) Heatmap analysis of the expression changes of auxin pathway genes in WT and _bhlh121_ mutant under salt stress. **A** _35S::PtbHLH121_ / _bhlh121-7_ **B** _35S::GsbHLH121_ / _bhlh121-7_ **C** _35S::CcbHLH121_ / _bhlh121-7_ **D** _35S::CsbHLH121_ / _bhlh121-7_ **Supplementary Fig. 9 Effects of ectopic expression of** _**bHLH121**_ **homologous** **genes in the** _**bhlh121-7**_ **mutant under salt stress.** (A-D) Relative fresh weight of 35S promoter driven _Populus_ _PtbHLH121_ (A), soybean _GsbHLH121_ (B), Citrus _CcbHLH121_ (C), and Cucumber _CsbHLH121_ (D) overexpression transgenic lines in _bhlh121-7_ background grown on ES medium supplemented with 100 mM NaCl for 10 days. The statistical differences were analyzed using a one-way ANOVA followed by Tukey’s multiple comparisons test. Different letters indicate significant differences ( _P_ < 0.05). WT _bhlh121_ mutant High salinity bHLH121 O 2 - – H 2 O 2 Decreased meristem size Inhibited root growth O 2 - – H 2 O 2 ROS homeostasis Salt tolerance **Supplementary Fig. 10 A proposed working model illustrating the role of** **bHLH121 in maintaining RAM size and root tip growth under salt stress in** _**Arabidopsis**_ **.** Under high salinity, bHLH121 positively regulates salt tolerance by orchestrating a complex regulatory network. bHLH121 promotes the expression of _CAT2_ and other ROS-related genes directly, as well as indirectly through the regulation of jasmonate (JA) and auxin signaling pathways. This regulation leads to an increase in H 2 O 2 clearance, effectively maintains ROS homeostasis and ultimately confers salt tolerance (middle panel). In wild-type (WT) roots, this bHLH121dependent mechanism maintains a proper balance between O 2 - - and H 2 O 2, ensuring normal root apical meristem size and root elongation under salt stress (left panel). In contrast, loss of function of bHLH121 ( _bhlh121_ mutant) disrupts this balance, resulting in excessive H 2 O 2 accumulation, reduced meristem size, and inhibited root growth, thereby decreasing salt tolerance (right panel). The balance scale at the bottom represents the relative ROS equilibrium. bHLH121 confers salt stress tolerance via direct regulation of CAT2, revealing a bHLH121–CAT2 module that operates independently of the bHLH121-mediated iron homeostasis pathway. [bioRxiv preprint doi: https://doi.org/10.64898/2026.11.02.763515; this version posted November 4, 2026. The copyright holder for this](https://doi.org/10.64898/2026.11.02.763515) preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in [perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license.](http://creativecommons.org/licenses/by-nc-nd/4.0/) **Table S1. Oligos used in this study.** **Purpose** **Primers** **Sequences (5'-3')** RT-qPCR Tubulin-RT-F GTGCTGAAGGTGGAGACGAT Tubulin-RT-R AACACGAAGACCGAACGAAT IRT1-RT-F CACCATTCGGAATAGCGTTAGG IRT1-RT-R CCAGCGGAGCATGCATTTA FRO2-RT-F GGCCACCACATATCCGAAGAT FRO2-RT-R CGACGTGGAGGACAAAGAAGAG RBOHD-RT-F GGATTCAAATACAAAAGTGGACAG RBOHD-RT-R GGATATGTACGCTCAGGTAATCG CAT2-RT-F TGCTGGAAACTACCCTGAATGG CAT2-RT-R TCAACACCATACGTCCAACAGG PRX8-RT-F CCATTGGGACCGTAACCGAA PRX8-RT-R GAACTTTGGACCACCCGCTA GH3.15-RT-F GTTGTTAAGCCTGGCGCTTT GH3.15-RT-R ACATTGTTCTCCTCCCCTGC JAZ1-RT-F AAAATGACACAGACTACCAG JAZ1-RT-R AGCAGAAAAGTCATTGAATA JAZ10-RT-F TCAGTTTTCCAAGTGTCTCGTA JAZ10-RT-R TACCGAAAGATCTGTCTCCATC PLT1-RT-F TCGCCGGAAACAAAGAC PLT1-RT-R CCGATGGGAAGAGTGCTAC PLT2-RT-F ACTCTTCTTTGCCGCCTCACAT PLT2-RT-R CCCCCGATTTGCTCACTCC SOS1-RT-F CGCATTATCACCTTCTAACGGG SOS1-RT-R GCTCCAAATGCTCCAATGTTG bHLH121-RT-F TGAGTACACCGCATTGACAGAT bHLH121-RT-R GATTGACCCGGGAGGCATAG His-TF-bHLH121 pCOLD-121-F CGGGGTACCATGGGGATAAGAGAAAATGGAA pCOLD-121-R CGCGGATCCtcaTTTTGCATCATCAGGTTTTTGG EMSA Bio-pCAT2-p1F TGTTGGATTCCACGTGTGATGAGATAGTGTGAACGCCCCAAGCG Bio-pCAT2-P1R CGCTTGGGGCGTTCACACTATCTCATCACACGTGGAATCCAACA Cold-pCAT2-p1F TGTTGGATTCCACGTGTGATGAGATAGTGTGAACGCCCCAAGCG Cold-pCAT2-p1R CGCTTGGGGCGTTCACACTATCTCATCACACGTGGAATCCAACA Cold-pCAT2-M-p1F TGTTGGATTCCTAGAGTGATGAGATAGTCTAGAGGCCCCAAGCG Cold-pCAT2-M-p1R CGCTTGGGGCCTCTAGACTATCTCATCACTCTAGGAATCCAACA **Table S2. List of differentially expressed genes in the roots between WT and** _**uri-2**_ **mutant.** **gene_id** **Col-0** **uri** **log2(uri/Col-0)** **q_value** AT1G47395 1.03123 8.60799 3.0613 0.00613065 AT1G47400 0.929148 6.73302 2.85727 0.00613065 AT5G04150 2.28779 13.0537 2.51242 0.0297101 AT5G24160 0.250609 1.05812 2.07799 0.00613065 AT2G41240 1.11389 4.36624 1.97078 0.00613065 AT5G60610 0.470101 1.7541 1.89969 0.00613065 AT2G17850 2.20114 8.14742 1.88809 0.0113181 AT5G10140 1.35214 4.81935 1.83359 0.00613065 AT5G64060 0.55852 1.91409 1.77698 0.0113181 AT1G15040 3.9698 13.1282 1.72553 0.0427168 AT1G65370 5.287 15.922 1.5905 0.00613065 AT3G60140 0.473419 1.36727 1.53011 0.00613065 AT1G15520 0.375568 1.07944 1.52313 0.00613065 AT1G08100 2.02864 5.50907 1.4413 0.00613065 AT1G15720 2.40289 6.45866 1.42646 0.00613065 AT1G15625 9.31559 23.0801 1.30893 0.00613065 AT1G21250 0.385376 0.949515 1.30092 0.0427168 AT1G14660 1.63252 4.01412 1.29799 0.00613065 AT5G05060 6.78054 16.3003 1.26543 0.00613065 AT2G43620 6.08408 14.5548 1.25838 0.00613065 AT1G15480 10.6288 25.283 1.2502 0.00613065 AT1G16030 3.30785 7.81769 1.24085 0.00613065 AT1G15385 3.30037 7.74318 1.2303 0.0254938 AT1G15460 7.45662 17.4934 1.23022 0.00613065 AT1G15710 9.97279 23.0323 1.20759 0.00613065 AT1G14630 10.1644 23.3963 1.20275 0.00613065 AT1G15420 28.3315 65.089 1.20001 0.00613065 AT1G14770 4.41913 10.1143 1.19457 0.00613065 AT1G14540 23.1702 52.9211 1.19157 0.00613065 AT1G15630 2.05743 4.66559 1.18121 0.00613065 AT1G14550 8.65982 19.5708 1.1763 0.00613065 AT1G14980 178.528 401.168 1.16806 0.00613065 AT1G16000 135.376 303.935 1.16679 0.00613065 AT1G15140 14.5142 32.4778 1.16199 0.00613065 AT1G15440 20.4853 45.7037 1.15772 0.00613065 AT1G15550 39.4531 87.9834 1.15709 0.00613065 AT1G14910 19.6677 43.6327 1.14958 0.00613065 AT1G15640 3.79224 8.35229 1.13912 0.00613065 AT1G14810 82.3863 181.397 1.13868 0.00613065 AT1G14710 34.5778 75.8859 1.13399 0.00613065 AT1G15530 5.92009 12.9749 1.13203 0.00613065 AT1G15810 32.6303 71.0722 1.12307 0.00613065 AT1G15950 197.968 429.842 1.11854 0.00613065 AT1G14620 46.452 100.847 1.11835 0.00613065 AT1G15930 499.251 1083.3 1.1176 0.00613065 AT1G14650 28.0519 60.8351 1.11681 0.00613065 AT1G14670 149.818 324.885 1.11672 0.00613065 AT1G15110 23.6822 50.8335 1.10198 0.00613065 AT1G15570 10.7701 23.0858 1.09998 0.00613065 AT1G15510 1.79929 3.83966 1.09355 0.00613065 AT1G14560 12.9557 27.2757 1.07403 0.00613065 AT1G16040 12.1662 25.4893 1.06702 0.00613065 AT1G15940 10.1976 21.1912 1.05524 0.00613065 AT2G16060 124.882 259.193 1.05346 0.00613065 AT1G14850 14.2354 29.431 1.04785 0.00613065 AT1G14410 8.13422 16.8103 1.04727 0.00613065 AT1G15000 10.9505 22.6091 1.0459 0.00613065 AT1G15470 23.4364 48.3829 1.04575 0.00613065 AT1G15130 49.8049 102.151 1.03635 0.00613065 AT1G15660 12.6364 25.8213 1.03098 0.00613065 AT1G15790 6.64976 13.5295 1.02473 0.00613065 AT1G15290 10.4625 21.2704 1.02362 0.00613065 AT1G14860 19.8462 40.2901 1.02156 0.00613065 AT1G14590 4.32273 8.76692 1.02013 0.00613065 AT4G10265 5.27224 10.6518 1.01461 0.0297101 AT1G15270 417.808 842.578 1.01197 0.00613065 AT1G14570 48.0594 96.7625 1.00963 0.00613065 AT1G14960 16.0041 32.1975 1.0085 0.00613065 AT1G14720 41.2375 82.8062 1.00578 0.00613065 AT1G14750 1.96236 3.92672 1.00073 0.00613065 AT1G15120 133.297 266.518 0.999592 0.00613065 AT1G14900 58.0641 115.797 0.995882 0.00613065 AT1G15910 13.7589 27.374 0.992445 0.00613065 AT1G15690 438.102 869.776 0.989378 0.00613065 AT1G15370 58.6392 116.354 0.988579 0.00613065 AT1G15220 5.89613 11.6848 0.986792 0.0165233 AT1G14610 63.2641 125.31 0.986038 0.00613065 AT1G15730 4.00126 7.88289 0.978272 0.00613065 AT2G24600 2.01422 3.95548 0.973635 0.00613065 AT1G77120 141.829 278.13 0.971608 0.00613065 AT1G15030 18.1656 35.6073 0.97096 0.00613065 AT1G14740 45.3128 88.8156 0.970892 0.00613065 AT1G15080 6.81557 13.3587 0.97087 0.00613065 AT1G15860 42.4135 82.9638 0.967958 0.00613065 AT1G15670 70.3279 137.544 0.967728 0.00613065 AT1G15020 19.1358 37.2415 0.96064 0.00613065 AT1G14450 294.61 571.784 0.956666 0.00613065 AT1G16020 12.8386 24.8326 0.951742 0.00613065 AT1G15100 122.102 235.858 0.949839 0.00613065 AT1G69880 14.9813 28.8572 0.94577 0.00613065 AT1G15500 142.773 274.932 0.945353 0.00613065 AT1G16010 31.5376 60.6062 0.942391 0.00613065 AT3G43190 34.0309 65.3793 0.941991 0.00613065 AT1G15210 88.6221 170.029 0.940041 0.00613065 AT1G14460 7.8694 15.0753 0.937862 0.00613065 AT1G15410 8.44945 16.1755 0.936882 0.00613065 AT1G34510 3.40208 6.47833 0.929207 0.0211272 AT1G15400 99.1263 188.488 0.927134 0.00613065 AT1G14400 199.291 378.023 0.923599 0.00613065 AT2G18480 1.29448 2.45241 0.921828 0.0254938 AT1G15780 19.1635 36.3032 0.921736 0.00613065 AT1G14600 2.55699 4.83211 0.918208 0.0211272 AT1G14970 6.18875 11.6794 0.916242 0.00613065 AT3G58270 4.13465 7.79606 0.91498 0.00613065 AT3G22550 6.13976 11.5381 0.910156 0.00613065 AT1G15880 39.1962 73.6257 0.909494 0.00613065 AT1G15280 25.4161 47.7118 0.908603 0.00613065 AT1G14830 86.0425 161.234 0.906034 0.00613065 AT1G14820 12.075 22.5293 0.899784 0.00613065 AT1G15340 51.4744 95.9516 0.898453 0.00613065 AT1G14870 209.253 389.073 0.89479 0.00613065 AT1G15060 12.2303 22.6762 0.890716 0.00613065 AT1G15240 14.4496 26.735 0.887696 0.00613065 AT1G15310 4.89524 9.03657 0.884396 0.00613065 AT4G33070 46.3816 85.3667 0.880122 0.00613065 AT1G14510 39.0631 71.8778 0.879742 0.00613065 AT4G16370 12.5362 23.0222 0.876932 0.00613065 AT1G14690 21.8092 40.0374 0.876412 0.00613065 AT3G55090 1.61618 2.96624 0.876051 0.0211272 AT1G15170 12.8843 23.518 0.868149 0.00613065 AT1G15350 61.5213 112.191 0.866802 0.00613065 AT1G14480 3.13426 5.70441 0.863953 0.00613065 AT1G15200 33.3589 60.5652 0.860419 0.00613065 AT1G15920 18.1548 32.5909 0.84412 0.00613065 AT1G14920 14.2957 25.5369 0.837001 0.00613065 AT3G14900 2.23171 3.984 0.836069 0.0427168 AT1G15490 13.9759 24.9049 0.833487 0.0211272 AT1G14890 20.3437 36.1427 0.829123 0.00613065 AT3G22060 5.68126 10.0099 0.81715 0.0113181 AT1G14685 30.204 53.0641 0.812997 0.00613065 AT1G15970 12.6395 22.2047 0.812928 0.00613065 AT1G14530 11.4117 20.0349 0.812005 0.00613065 AT1G15230 27.0258 47.1862 0.804025 0.00613065 AT1G56430 8.52337 14.8483 0.800802 0.00613065 AT5G23220 15.9536 27.616 0.791622 0.00613065 AT1G15890 3.55166 6.11078 0.782863 0.00613065 AT1G15380 194.416 329.818 0.762522 0.00613065 AT1G43800 98.4506 166.772 0.760405 0.00613065 AT1G15760 6.81349 11.4569 0.749746 0.0113181 AT4G00380 2.72523 4.57662 0.747907 0.0344959 AT5G50260 4.59171 7.70559 0.746875 0.0297101 AT4G14020 19.7487 33.0979 0.744983 0.0113181 AT3G44300 27.1384 44.8407 0.724472 0.00613065 AT1G14730 48.5784 79.9284 0.718394 0.00613065 AT3G10040 8.29197 13.638 0.717841 0.00613065 AT1G19530 31.0902 50.982 0.713531 0.00613065 AT3G28580 5.83045 9.56047 0.713474 0.0427168 AT5G39890 24.1367 39.199 0.699586 0.00613065 AT1G14580 5.16217 8.32888 0.690144 0.0211272 AT5G25610 5.37131 8.62891 0.683905 0.0211272 AT4G33560 47.5206 76.0476 0.678351 0.00613065 AT1G30760 9.75843 15.5985 0.676686 0.00613065 AT4G27450 62.1218 98.8377 0.669962 0.00613065 AT2G33790 60.7682 94.6934 0.639948 0.00613065 AT5G23570 5.80771 8.92666 0.620152 0.0254938 AT3G02550 39.2398 60.1715 0.616763 0.00613065 AT1G77145 12.8848 19.6746 0.61066 0.0211272 AT2G41480 20.7285 13.5275 -0.615717 0.0254938 AT3G62740 17.2671 11.1998 -0.624563 0.0113181 AT2G22330 60.814 39.3834 -0.626817 0.00613065 AT3G26460 29.0554 18.786 -0.629148 0.0254938 AT5G15180 40.5213 26.1708 -0.630723 0.0113181 AT1G73330 624.771 402.891 -0.632937 0.00613065 AT4G13290 11.3421 7.25524 -0.644597 0.0113181 AT5G27030 13.7892 8.81999 -0.644694 0.00613065 AT3G12900 14.1395 9.0431 -0.644846 0.0461861 AT2G01520 635.054 395.675 -0.682562 0.0165233 AT5G54700 14.3818 8.65487 -0.732661 0.00613065 AT1G14120 20.2735 12.1588 -0.737596 0.00613065 AT4G11320 372.05 222.167 -0.743854 0.00613065 AT5G02780 27.9311 16.5936 -0.751247 0.00613065 AT1G73120 62.9357 37.2449 -0.756836 0.00613065 AT3G20340 24.8679 14.6638 -0.762024 0.0113181 AT3G22240 55.0221 32.2037 -0.772783 0.0461861 AT4G08290 12.2207 7.10545 -0.782326 0.0254938 AT3G49160 4.25018 2.46088 -0.788351 0.0211272 AT3G47640 10.1926 5.84962 -0.801112 0.0254938 AT1G72140 9.86448 5.55051 -0.829622 0.00613065 AT1G52410 3.35209 1.85636 -0.852586 0.0113181 AT2G34490 6.41321 3.54437 -0.855518 0.00613065 AT5G37990 40.6422 22.4488 -0.856344 0.00613065 AT3G58810 23.3966 12.8145 -0.86852 0.00613065 AT4G23680 26.359 14.4092 -0.871309 0.00613065 AT1G72490 3.99352 2.14559 -0.896287 0.0113181 AT5G38000 5.83722 3.03904 -0.941665 0.0165233 AT1G77520 11.6097 6.00682 -0.950662 0.00613065 AT3G08040 29.5889 15.2733 -0.954041 0.00613065 AT1G26240 2.70535 1.38874 -0.96204 0.0461861 AT4G39770 5.74917 2.93487 -0.970059 0.0113181 AT1G01580 103.509 52.4795 -0.979924 0.00613065 AT4G14060 24.8019 12.0472 -1.04176 0.00613065 AT4G19690 207.362 100.365 -1.04689 0.00613065 AT5G38820 4.80123 2.28234 -1.07289 0.00613065 AT2G27402 6.64087 3.08277 -1.10715 0.00613065 AT2G35736 33.8783 14.5214 -1.22217 0.00613065 AT1G76800 28.8382 12.2697 -1.23289 0.00613065 AT5G24770 24.3481 10.264 -1.24621 0.00613065 AT1G62540 2.36524 0.992223 -1.25325 0.0113181 AT5G28080 5.5502 2.30932 -1.26507 0.00613065 AT4G31970 4.13761 1.70468 -1.2793 0.00613065 AT1G21140 62.0205 25.0227 -1.30951 0.00613065 AT3G25190 180.017 72.3508 -1.31505 0.00613065 AT3G45680 4.5897 1.79058 -1.35797 0.00613065 AT1G21230 2.0213 0.6509 -1.63477 0.00613065 AT5G24780 10.4958 3.05583 -1.78018 0.00613065 AT3G33528 3.56218 0.996558 -1.83774 0.00613065 AT4G09200 2.43027 0.145525 -4.06177 0.00613065 **Table S3. List of salt-responsive differentially expressed genes in the roots of WT.** **gene_id** **ES_Col_root** **NaCl_Col_root** **log2(NaCl/ES)** **q_value** AT2G27535 0.637514 13.1296 4.36423 0.000896771 AT2G37870 2.61891 47.3233 4.17551 0.000896771 AT1G02820 0.591774 9.59289 4.01885 0.000896771 AT5G50580 0.277816 3.39526 3.61132 0.000896771 AT1G08100 2.01997 23.3097 3.52852 0.000896771 AT4G15370 0.584199 6.5272 3.48193 0.000896771 AT2G24560 0.110446 1.14907 3.37905 0.0108179 AT1G77160 0.620507 6.01415 3.27684 0.000896771 AT4G13420 8.19619 74.9557 3.19301 0.000896771 AT5G08000 0.223752 1.99098 3.15351 0.00165892 AT5G40800 0.131614 1.15826 3.13758 0.0148175 AT1G23201 0.452828 3.63302 3.00413 0.00479593 AT5G13370 0.652746 5.1364 2.97616 0.000896771 AT1G30560 0.213229 1.64713 2.94948 0.000896771 AT2G17660 3.45521 26.4269 2.93516 0.00747871 AT1G75250 0.995307 7.58221 2.9294 0.000896771 AT4G18280 10.0773 75.6028 2.90732 0.000896771 AT2G28850 0.492676 3.64499 2.8872 0.000896771 AT4G21250 2.59612 19.0937 2.87867 0.000896771 AT1G60050 3.93578 28.8851 2.8756 0.000896771 AT4G38410 5.10613 35.1773 2.78434 0.000896771 AT1G34510 3.38755 23.2757 2.78051 0.000896771 AT2G39510 7.45413 49.3685 2.72748 0.000896771 AT2G03710 0.108002 0.678513 2.65131 0.0264303 AT5G59320 23.751 148.999 2.64924 0.000896771 AT1G66860 0.285345 1.75399 2.61986 0.000896771 AT2G41905 0.345991 2.09047 2.59502 0.0389047 AT5G47150 0.175461 0.993458 2.50131 0.0244475 AT3G09855 0.588045 3.30091 2.48887 0.0378318 AT1G47400 0.92518 5.18742 2.48721 0.000896771 AT1G09310 1.51129 8.27949 2.45376 0.00747871 AT5G39493 0.34672 1.89292 2.44877 0.0375273 AT2G19900 0.983685 5.26222 2.4194 0.000896771 AT3G02410 0.142411 0.746352 2.3898 0.0479331 AT1G02040 0.22732 1.18642 2.38382 0.0209346 AT5G65980 10.4636 54.3984 2.37819 0.000896771 AT1G14520 0.909172 4.70312 2.37099 0.000896771 AT4G12490 79.3829 409.838 2.36816 0.000896771 AT1G53880 0.448273 2.3109 2.36601 0.000896771 AT2G36695 1.24769 6.41358 2.36187 0.00363145 AT5G52390 0.449718 2.2714 2.33649 0.00235351 AT1G47395 1.02683 5.15681 2.32828 0.000896771 AT1G53130 7.94338 39.7781 2.32415 0.000896771 AT5G59220 0.599669 2.97078 2.3086 0.000896771 AT1G64900 3.21023 15.6288 2.28346 0.000896771 AT1G22150 0.130048 0.626577 2.26844 0.00591387 AT5G59340 0.367886 1.75944 2.25778 0.00165892 AT1G62290 0.358938 1.71484 2.25627 0.000896771 AT2G39010 6.76295 32.2125 2.25189 0.000896771 AT5G06760 0.652101 3.1039 2.25092 0.00363145 AT5G63350 0.476997 2.21157 2.21302 0.000896771 AT1G34047 2.24948 10.4185 2.21149 0.000896771 AT5G25190 2.08688 9.60006 2.2017 0.000896771 AT1G70260 19.5734 89.7305 2.19671 0.000896771 AT3G22120 9.59941 43.6397 2.18462 0.000896771 AT1G02850 8.46575 38.2107 2.17427 0.000896771 AT2G02990 2.62176 11.7122 2.1594 0.000896771 AT2G43510 1.01668 4.5227 2.15332 0.000896771 AT3G48510 0.377208 1.66642 2.14332 0.00533178 AT3G28540 0.496023 2.14792 2.11446 0.000896771 AT3G60090 0.663958 2.85531 2.10449 0.000896771 AT2G35637 0.464277 1.99516 2.10345 0.00301378 AT1G61750 0.679984 2.90495 2.09494 0.000896771 AT5G46370 0.127965 0.546141 2.09353 0.0447944 AT3G44290 0.464532 1.98089 2.0923 0.00165892 AT1G48800 0.392534 1.65602 2.07683 0.000896771 AT1G16850 15.5504 65.4097 2.07255 0.000896771 AT1G55980 0.532932 2.22203 2.05985 0.000896771 AT1G65490 1.75225 7.30165 2.05902 0.0156503 AT5G14360 2.23582 9.21035 2.04245 0.000896771 AT3G11180 0.200227 0.824045 2.04109 0.0251315 AT3G48580 0.276443 1.12756 2.02815 0.0223616 AT5G28510 0.958223 3.85699 2.00904 0.000896771 AT1G18100 7.41759 29.7294 2.00287 0.000896771 AT1G52400 0.179617 0.717401 1.99785 0.00844354 AT5G15960 77.2422 305.361 1.98306 0.000896771 AT1G24270 0.473919 1.87041 1.98064 0.0209346 AT1G08440 0.281209 1.1094 1.98006 0.00235351 AT3G02480 1.40333 5.51005 1.97322 0.00798094 AT5G44575 0.668888 2.6112 1.96488 0.0342164 AT3G45060 2.0647 8.00127 1.9543 0.000896771 AT2G13810 1.35908 5.24379 1.94798 0.000896771 AT5G19880 0.336355 1.28678 1.93571 0.0165092 AT3G24290 0.97496 3.72227 1.93277 0.000896771 AT5G35940 3.99822 15.2046 1.92708 0.000896771 AT2G17850 2.19174 8.30128 1.92126 0.000896771 AT5G43590 0.691086 2.61694 1.92094 0.000896771 AT3G48740 0.718066 2.69706 1.9092 0.00165892 AT1G65620 0.453345 1.69976 1.90665 0.00533178 AT2G34320 0.366953 1.37131 1.90189 0.0469434 AT3G11260 1.18813 4.43124 1.89903 0.000896771 AT1G64110 1.64505 6.07995 1.88592 0.000896771 AT1G69880 14.9173 54.5075 1.86947 0.000896771 AT1G65390 0.359121 1.29174 1.84678 0.0152135 AT5G42580 0.55503 1.9961 1.84655 0.000896771 AT1G67105 1.89204 6.77965 1.84127 0.000896771 AT4G22610 2.12229 7.59988 1.84035 0.000896771 AT5G39220 0.209257 0.74501 1.83198 0.035176 AT3G02832 0.773176 2.74031 1.82547 0.00363145 AT3G13784 9.45254 33.4905 1.82498 0.000896771 AT1G51870 0.740594 2.62313 1.82453 0.000896771 AT2G27550 47.2054 167.152 1.82413 0.000896771 AT4G27550 0.232771 0.823934 1.82362 0.00235351 AT2G04190 4.71843 16.6922 1.8228 0.000896771 AT2G14210 1.83277 6.48123 1.82224 0.000896771 AT1G60590 1.26108 4.45313 1.82016 0.000896771 AT3G44300 27.0225 94.275 1.80271 0.000896771 AT5G07200 0.513561 1.78769 1.79949 0.000896771 AT2G38530 24.8861 86.063 1.79005 0.000896771 AT3G53720 0.158466 0.545281 1.78283 0.00646759 AT5G55110 7.56814 25.9541 1.77795 0.000896771 AT4G12480 377.366 1286.92 1.76988 0.000896771 AT1G69530 47.0656 160.02 1.7655 0.000896771 AT3G14210 0.268759 0.912615 1.76369 0.0139458 AT3G04320 29.1584 98.6678 1.75867 0.000896771 AT2G35612 1.31007 4.41057 1.75132 0.00479593 AT3G19200 5.2158 17.532 1.74903 0.000896771 AT5G45350 49.8259 167.384 1.74819 0.000896771 AT4G00165 2.34272 7.84143 1.74293 0.00165892 AT5G65140 6.68236 22.3653 1.74283 0.000896771 AT2G43870 4.04368 13.454 1.73429 0.000896771 AT1G52700 4.59522 15.2817 1.73359 0.000896771 AT2G13610 0.826986 2.74249 1.72955 0.000896771 AT1G11920 2.65043 8.76598 1.72569 0.000896771 AT2G39490 0.624685 2.06114 1.72224 0.00165892 AT1G70510 0.33303 1.09817 1.72138 0.0099436 AT4G25010 1.83363 6.01968 1.71499 0.000896771 AT3G52780 1.34927 4.39416 1.70341 0.000896771 AT1G76470 0.284637 0.926357 1.70245 0.0234299 AT4G22470 7.31456 23.725 1.69757 0.000896771 AT5G26220 0.901668 2.91071 1.6907 0.000896771 AT2G05510 78.6362 252.366 1.68225 0.000896771 AT4G25220 5.26065 16.8299 1.67772 0.000896771 AT3G43860 0.188793 0.603656 1.67692 0.0165092 AT4G26880 1.60083 5.11409 1.67566 0.000896771 AT2G39800 15.595 49.7199 1.67274 0.000896771 AT1G02813 1.55894 4.94958 1.66674 0.00591387 AT2G05520 3.48863 11.0633 1.66505 0.000896771 AT5G01380 0.394231 1.24713 1.6615 0.0223616 AT2G26740 0.962121 3.03321 1.65656 0.000896771 AT5G25610 5.34837 16.6822 1.64114 0.000896771 AT2G34930 3.37489 10.4971 1.63707 0.000896771 AT4G25310 17.5196 54.389 1.63434 0.000896771 AT2G36210 12.9405 39.7864 1.62039 0.000896771 AT3G60140 0.471397 1.44502 1.61608 0.000896771 AT1G15980 0.224364 0.68775 1.61604 0.0389047 AT4G31330 5.02664 15.3854 1.61389 0.000896771 AT2G02580 1.26679 3.87208 1.61193 0.000896771 AT5G45630 1.36299 4.14895 1.60597 0.00363145 AT4G30140 77.9571 233.664 1.58368 0.000896771 AT3G26820 0.4686 1.39329 1.57207 0.000896771 AT1G65670 1.51874 4.50903 1.56995 0.000896771 AT2G31470 0.60502 1.76856 1.54752 0.0117292 AT1G65570 8.03807 23.3409 1.53794 0.000896771 AT4G15350 2.12175 6.15515 1.53654 0.000896771 AT3G09390 26.2395 76.001 1.53428 0.000896771 AT2G21510 1.78199 5.15777 1.53326 0.000896771 AT1G21340 1.32685 3.83375 1.53075 0.00165892 AT4G19200 141.905 409.95 1.53052 0.000896771 AT1G18835 1.87964 5.41907 1.52759 0.00844354 AT4G21680 17.454 50.2685 1.5261 0.000896771 AT4G36220 15.0395 43.3102 1.52595 0.000896771 AT1G05230 0.461941 1.32603 1.52134 0.0121949 AT5G60520 24.8459 71.2788 1.52047 0.000896771 AT5G38700 7.55531 21.5576 1.51264 0.000896771 AT3G13950 1.24478 3.52158 1.50034 0.000896771 AT4G39410 0.498084 1.39642 1.48727 0.0172723 AT2G05430 0.627569 1.75789 1.486 0.00479593 AT4G09500 1.63349 4.55279 1.47879 0.000896771 AT2G43890 12.3773 34.4191 1.47551 0.000896771 AT1G65680 6.67519 18.4857 1.46953 0.000896771 AT3G20850 1.22697 3.37499 1.45978 0.0419469 AT3G24540 0.687816 1.88272 1.45273 0.000896771 AT1G32900 0.273358 0.748012 1.45227 0.0165092 AT1G67470 0.843182 2.29258 1.44305 0.000896771 AT4G25790 19.0709 51.7171 1.43927 0.000896771 AT5G39490 0.286225 0.775705 1.43836 0.035753 AT5G20820 16.6356 45.0702 1.4379 0.000896771 AT3G51750 3.09122 8.32422 1.42914 0.00423503 AT4G02330 11.0646 29.7589 1.42736 0.000896771 AT3G09950 3.50807 9.41523 1.42432 0.000896771 AT1G48670 4.31305 11.5674 1.42328 0.000896771 AT1G26770 7.82 20.9674 1.42291 0.000896771 AT4G39830 2.14184 5.737 1.42145 0.000896771 AT1G68765 1.432 3.83528 1.4213 0.00423503 AT1G60470 9.52682 25.5139 1.42122 0.000896771 AT4G18450 0.538772 1.44014 1.41846 0.0445386 AT2G43600 3.07764 8.2103 1.41561 0.000896771 AT5G24070 10.5313 28.0736 1.41452 0.000896771 AT5G64990 0.57442 1.53093 1.41423 0.0445386 AT3G15650 16.1315 42.9521 1.41285 0.0264303 AT1G69480 0.969661 2.57028 1.40638 0.000896771 AT4G33550 15.3869 40.5698 1.3987 0.000896771 AT3G02885 144.493 380.094 1.39536 0.000896771 AT1G74010 20.3857 53.6215 1.39526 0.000896771 AT2G44000 0.98262 2.58019 1.39277 0.000896771 AT3G03280 7.12748 18.7036 1.39185 0.000896771 AT2G38490 1.52779 3.99229 1.38577 0.000896771 AT1G22490 1.1948 3.10813 1.37928 0.000896771 AT3G61198 2.14597 5.58044 1.37875 0.00798094 AT5G59760 1.895 4.92644 1.37834 0.0378318 AT4G16690 0.354981 0.922081 1.37715 0.0450489 AT5G17800 6.19436 16.05 1.37354 0.000896771 AT1G12845 4.47662 11.5912 1.37255 0.000896771 AT4G12470 151.329 391.264 1.37046 0.000896771 AT1G71380 1.7335 4.48092 1.3701 0.000896771 AT4G01360 0.840392 2.1696 1.36829 0.00479593 AT2G43660 2.50668 6.43743 1.36071 0.0184677 AT2G02250 1.65926 4.25708 1.35932 0.00165892 AT1G63580 2.21433 5.6802 1.35907 0.00165892 AT4G30650 95.7114 242.673 1.34225 0.000896771 AT4G19810 160.021 405.228 1.34047 0.000896771 AT2G43440 0.616484 1.56078 1.34013 0.014407 AT5G24600 1.19984 3.03695 1.33978 0.000896771 AT5G50260 4.5721 11.5261 1.33398 0.000896771 AT4G23590 1.61632 4.06665 1.33113 0.000896771 AT3G10986 2.16521 5.44233 1.32972 0.000896771 AT2G33790 60.5087 151.986 1.32873 0.000896771 AT1G77145 12.8298 32.2098 1.328 0.000896771 AT4G21780 2.02363 5.07444 1.32631 0.00479593 AT5G19110 8.99347 22.4242 1.31811 0.000896771 AT4G33020 4.82024 12.0146 1.31761 0.000896771 AT1G49100 1.28198 3.1899 1.31514 0.000896771 AT2G23120 473.641 1172.96 1.30829 0.000896771 AT5G25440 8.04011 19.8917 1.30688 0.000896771 AT1G64680 0.641794 1.58232 1.30186 0.0227039 AT4G36110 1.44822 3.56634 1.30016 0.00747871 AT1G54820 0.280008 0.689121 1.29929 0.035176 AT2G31480 0.893213 2.19612 1.29788 0.000896771 AT5G03360 0.41928 1.03 1.29666 0.000896771 AT5G45090 0.723795 1.77669 1.29554 0.0273764 AT2G19970 113.203 276.72 1.28952 0.000896771 AT1G01470 99.638 242.553 1.28353 0.000896771 AT3G54363 11.837 28.7112 1.27831 0.000896771 AT2G29000 0.513304 1.2439 1.27698 0.00301378 AT2G29120 0.359695 0.871531 1.27678 0.00235351 AT2G38823 0.758535 1.83729 1.27629 0.0257703 AT2G21610 1.32403 3.1974 1.27196 0.00165892 AT3G26290 16.5708 39.9993 1.27133 0.000896771 AT3G04420 8.75079 21.1036 1.27001 0.000896771 AT3G51420 0.754013 1.8148 1.26715 0.00165892 AT1G69490 2.26967 5.45544 1.26521 0.000896771 AT2G34390 3.76683 9.05186 1.26486 0.0270907 AT1G13590 26.8626 64.5439 1.26468 0.000896771 AT1G07175 6.4199 15.4213 1.2643 0.00235351 AT5G13910 17.8679 42.8678 1.26253 0.000896771 AT2G32210 4.90909 11.7698 1.26156 0.000896771 AT2G39518 22.6033 54.0986 1.25906 0.000896771 AT1G66840 0.357308 0.853761 1.25666 0.0161065 AT3G47340 63.8995 152.517 1.25509 0.000896771 AT5G40780 111.573 265.822 1.25247 0.000896771 AT2G43570 19.2345 45.7668 1.25061 0.000896771 AT5G49850 23.2953 55.3885 1.24954 0.000896771 AT1G76640 2.12545 5.05186 1.24905 0.0213118 AT5G14650 198.595 471.57 1.24764 0.000896771 AT2G28690 22.6804 53.7379 1.24449 0.000896771 AT2G14247 1.92634 4.55521 1.24166 0.000896771 AT1G65486 10.648 25.1663 1.24091 0.0190859 AT3G49620 0.70127 1.65738 1.24086 0.0108179 AT5G53030 0.540808 1.27789 1.24057 0.0459022 AT5G47220 4.54222 10.728 1.23991 0.000896771 AT5G36220 1.74394 4.10774 1.23599 0.000896771 AT3G20300 3.43588 8.0855 1.23466 0.000896771 AT1G62262 2.76679 6.48059 1.22791 0.000896771 AT1G29240 3.0839 7.21155 1.22555 0.000896771 AT5G24313 15.3229 35.7255 1.22126 0.000896771 AT3G24310 0.757853 1.76568 1.22023 0.0202455 AT2G19990 52.4444 121.483 1.21189 0.000896771 AT4G35070 0.827448 1.91332 1.20933 0.00533178 AT5G43330 31.1715 72.047 1.20871 0.000896771 AT2G24762 31.6897 72.9428 1.20275 0.000896771 AT1G58360 22.002 50.4868 1.19827 0.000896771 AT5G62530 40.3836 92.4884 1.1955 0.000896771 AT4G23515 1.39412 3.1876 1.19312 0.00363145 AT2G31220 0.606181 1.38574 1.19283 0.0216556 AT5G58330 16.9797 38.5709 1.1837 0.00844354 AT1G78490 2.90963 6.5997 1.18157 0.000896771 AT3G42180 18.8242 42.6924 1.18139 0.000896771 AT4G13500 1.61402 3.65677 1.17991 0.049716 AT5G53810 0.811846 1.83623 1.17747 0.00697391 AT1G22630 1.28341 2.89876 1.17545 0.0437319 AT2G30220 0.783093 1.76617 1.17337 0.0251315 AT4G21120 3.00645 6.77915 1.17304 0.000896771 AT1G64405 17.2347 38.7927 1.17047 0.000896771 AT5G52860 1.44233 3.24203 1.1685 0.000896771 AT5G65320 13.7933 30.9059 1.16392 0.000896771 AT2G02120 91.4642 204.152 1.15836 0.000896771 AT2G39380 16.0624 35.68 1.15143 0.000896771 AT4G15490 1.68397 3.73562 1.14948 0.000896771 AT4G12500 35.2837 78.1695 1.14761 0.000896771 AT5G56080 104.444 231.226 1.14658 0.000896771 AT4G01630 195.241 431.944 1.14559 0.000896771 AT2G29340 5.31288 11.6873 1.13737 0.000896771 AT1G54575 21.344 46.939 1.13696 0.000896771 AT2G43580 1.08847 2.38313 1.13056 0.0273764 AT3G01600 0.930594 2.03741 1.13051 0.00747871 AT4G34970 3.25099 7.10913 1.12879 0.00301378 AT5G65870 4.61462 10.0838 1.12775 0.000896771 AT5G59030 3.70729 8.09592 1.12683 0.000896771 AT3G61190 8.79248 19.1889 1.12593 0.000896771 AT4G38340 2.38383 5.18812 1.12193 0.000896771 AT3G15370 10.598 23.0512 1.12105 0.000896771 AT5G41670 245.452 533.076 1.1189 0.000896771 AT1G80450 1.83417 3.9712 1.11445 0.000896771 AT3G03660 1.4209 3.07644 1.11445 0.00946099 AT5G47550 16.2243 35.1038 1.11347 0.000896771 AT3G51510 3.20515 6.93459 1.11342 0.000896771 AT2G29500 5.22791 11.3092 1.11319 0.000896771 AT2G40910 0.544769 1.17763 1.11216 0.0437319 AT3G58060 1.9359 4.18288 1.11149 0.000896771 AT2G37760 28.9672 62.5249 1.11001 0.000896771 AT1G09070 82.4784 177.489 1.10564 0.000896771 AT1G29600 0.6193 1.33211 1.105 0.043471 AT3G50710 0.824551 1.77145 1.10325 0.014407 AT5G10990 6.40777 13.7478 1.1013 0.000896771 AT3G52561 5.74721 12.3108 1.09899 0.00235351 AT3G55700 3.52341 7.53577 1.09678 0.000896771 AT2G30140 7.16521 15.3074 1.09514 0.000896771 AT4G30290 56.5004 120.413 1.09165 0.000896771 AT4G15393 98.9637 210.719 1.09035 0.000896771 AT2G31083 6.34175 13.5007 1.09008 0.000896771 AT1G51035 5.74905 12.2341 1.08951 0.0202455 AT2G15090 0.934421 1.98785 1.08906 0.0103576 AT2G16660 113.304 241.001 1.08884 0.000896771 AT2G43610 163.27 346.746 1.08662 0.000896771 AT4G33120 4.44511 9.43679 1.08608 0.000896771 AT4G11350 2.51296 5.33347 1.08569 0.000896771 AT5G66460 12.4735 26.4687 1.08542 0.000896771 AT1G20190 26.8156 56.8674 1.08453 0.000896771 AT1G06460 3.84117 8.13178 1.08203 0.0251315 AT2G24600 2.00562 4.24351 1.08121 0.000896771 AT2G24820 6.45853 13.6415 1.07873 0.000896771 AT1G01070 13.6687 28.8612 1.07825 0.000896771 AT1G56430 8.48697 17.8974 1.07643 0.000896771 AT3G05550 1.95145 4.11507 1.07637 0.0260681 AT1G50090 2.16154 4.55632 1.07581 0.00423503 AT2G48080 23.4349 49.2666 1.07195 0.000896771 AT1G68880 29.5983 62.1649 1.07059 0.000896771 AT3G17600 2.46429 5.17321 1.06989 0.00697391 AT3G13640 0.59915 1.25666 1.0686 0.014407 AT3G14395 14.8965 31.2195 1.06747 0.000896771 AT1G03340 2.55637 5.35492 1.06677 0.000896771 AT3G20500 21.1456 44.2189 1.0643 0.000896771 AT3G14360 6.29847 13.1285 1.05963 0.000896771 AT3G06020 5.54754 11.551 1.0581 0.000896771 AT1G78230 4.66691 9.69868 1.05532 0.000896771 AT1G49310 58.572 121.665 1.05463 0.000896771 AT2G41240 1.10914 2.30067 1.05261 0.0471719 AT4G24110 10.5894 21.9601 1.05227 0.000896771 AT5G35525 5.17125 10.7155 1.05112 0.00165892 AT1G66130 0.70889 1.46591 1.04817 0.0419469 AT4G29610 1.49477 3.08993 1.04765 0.0126605 AT1G18197 1.22626 2.53295 1.04656 0.049716 AT1G66200 1862.67 3847.17 1.04642 0.000896771 AT5G18840 16.3381 33.7417 1.04629 0.000896771 AT5G59590 0.912694 1.8785 1.04138 0.0139458 AT2G36690 11.1392 22.9146 1.04063 0.000896771 AT5G40210 2.54939 5.23662 1.03849 0.000896771 AT5G44820 9.25008 18.9965 1.03819 0.000896771 AT1G60740 12.6862 25.8564 1.02726 0.000896771 AT5G08360 14.2567 29.0504 1.02692 0.00165892 AT5G51810 0.642502 1.30889 1.02657 0.0482404 AT3G59850 8.21578 16.7021 1.02356 0.000896771 AT1G56660 48.5648 98.67 1.0227 0.000896771 AT3G51000 44.3952 90.0867 1.02091 0.000896771 AT5G24280 0.836644 1.69678 1.02011 0.000896771 AT1G61390 0.486397 0.986439 1.02009 0.0190859 AT4G18810 1.59237 3.22659 1.01884 0.000896771 AT5G50130 1.87295 3.79072 1.01716 0.00235351 AT2G25680 10.007 20.2408 1.01625 0.000896771 AT2G47520 3.06107 6.18401 1.01451 0.0112625 AT1G08090 1271.33 2566.95 1.01371 0.000896771 AT2G38250 0.877464 1.77118 1.0133 0.0148175 AT1G25460 1.88006 3.77452 1.00551 0.00646759 AT1G04490 2.85007 5.71158 1.00289 0.000896771 AT1G76952 7.84285 15.7165 1.00283 0.0172723 AT5G16080 1.87341 3.7532 1.00246 0.00165892 AT1G70880 3.14506 1.56874 -1.00348 0.0324105 AT1G60270 6.73753 3.35675 -1.00515 0.000896771 AT5G09440 47.4976 23.6638 -1.00518 0.000896771 AT1G11070 1.74795 0.870453 -1.00582 0.00844354 AT1G53163 3.09904 1.54323 -1.00587 0.0126605 AT3G57020 182.297 90.7586 -1.00619 0.000896771 AT1G27140 32.2209 16.0413 -1.0062 0.000896771 AT3G50350 73.7132 36.6915 -1.00648 0.000896771 AT3G23730 29.2549 14.5472 -1.00793 0.000896771 AT4G10550 9.66983 4.79714 -1.01132 0.000896771 AT5G59520 39.6113 19.6475 -1.01157 0.000896771 AT5G22920 30.0246 14.8838 -1.0124 0.000896771 AT5G56550 7.60171 3.76468 -1.0138 0.00301378 AT1G64200 63.6411 31.5082 -1.01423 0.000896771 AT4G37400 15.1513 7.49206 -1.01601 0.000896771 AT2G28305 3.18611 1.57407 -1.0173 0.0117292 AT2G05070 4.12545 2.03527 -1.01933 0.0117292 AT5G54790 12.6633 6.24639 -1.01956 0.000896771 AT1G21320 3.5862 1.76735 -1.02087 0.0108179 AT4G13290 11.2937 5.5645 -1.02119 0.000896771 AT3G54150 7.03293 3.46321 -1.02202 0.0108179 AT3G02850 12.0806 5.94803 -1.0222 0.000896771 AT4G18670 12.1559 5.97681 -1.02421 0.000896771 AT3G59710 2.39918 1.17896 -1.02503 0.0312181 AT1G21580 10.4436 5.12725 -1.02636 0.000896771 AT1G28330 134.643 66.0802 -1.02685 0.000896771 AT4G22780 10.8847 5.34026 -1.02732 0.000896771 AT5G28770 35.3567 17.3233 -1.02927 0.000896771 AT1G46768 7.48948 3.66825 -1.02977 0.00165892 AT2G42900 3.60084 1.76185 -1.03124 0.0187934 AT5G08370 6.79961 3.32674 -1.03134 0.0386644 AT3G07425 12.7465 6.23288 -1.03214 0.00591387 AT2G40330 58.9787 28.7877 -1.03474 0.000896771 AT1G15625 9.27581 4.51576 -1.0385 0.000896771 AT2G38760 9.63353 4.6891 -1.03875 0.000896771 AT2G01950 38.4032 18.6869 -1.0392 0.000896771 AT3G24715 3.95944 1.92662 -1.03923 0.0103576 AT2G25590 2.43334 1.18273 -1.04082 0.0184677 AT1G63450 9.21596 4.47384 -1.04262 0.000896771 AT1G53230 9.37772 4.54777 -1.04408 0.000896771 AT1G30210 12.2569 5.94185 -1.04461 0.000896771 AT5G60350 2.33121 1.12841 -1.04679 0.0209346 AT4G25640 115.535 55.6539 -1.05377 0.000896771 AT1G76020 16.7312 8.05899 -1.05387 0.000896771 AT3G10470 2.9495 1.42003 -1.05455 0.00301378 AT1G53440 13.5228 6.50344 -1.05612 0.000896771 AT1G72150 225.551 108.271 -1.05881 0.000896771 AT3G45390 2.70248 1.29724 -1.05884 0.00235351 AT2G43535 64.7388 31.0007 -1.06233 0.000896771 AT5G53500 11.7397 5.62013 -1.06272 0.000896771 AT4G24580 6.89828 3.29961 -1.06394 0.000896771 AT1G63530 6.94666 3.32145 -1.06451 0.000896771 AT4G01970 9.14125 4.36586 -1.06612 0.000896771 AT4G31110 6.12821 2.92368 -1.06768 0.000896771 AT4G15230 8.43456 4.0234 -1.0679 0.000896771 AT2G18470 2.20244 1.04852 -1.07075 0.00235351 AT2G20340 5.47851 2.60734 -1.0712 0.000896771 AT2G07680 5.27893 2.51063 -1.0722 0.000896771 AT1G13210 21.8659 10.3968 -1.07254 0.000896771 AT2G25900 29.6501 14.0913 -1.07323 0.000896771 AT3G61750 10.7078 5.08857 -1.07333 0.000896771 AT3G52840 6.5117 3.0936 -1.07375 0.000896771 AT5G28400 2.11636 1.00425 -1.07547 0.000896771 AT1G19050 25.647 12.1511 -1.07771 0.000896771 AT4G34900 0.898861 0.425413 -1.07923 0.00697391 AT3G45080 3.40205 1.6099 -1.07943 0.00533178 AT3G61430 635.679 299.906 -1.08379 0.000896771 AT1G78440 3.06712 1.44699 -1.08383 0.0099436 AT1G03990 1.27511 0.601449 -1.0841 0.0152135 AT5G65390 81.5775 38.4552 -1.08499 0.000896771 AT3G59930 289.548 136.425 -1.0857 0.000896771 AT4G21850 203.923 95.9644 -1.08745 0.000896771 AT1G72920 1.80726 0.850143 -1.08803 0.0354792 AT2G31900 8.93759 4.19784 -1.09024 0.000896771 AT4G14130 88.5042 41.461 -1.09399 0.000896771 AT2G46660 2.45396 1.14791 -1.0961 0.00165892 AT1G02205 1.86225 0.870125 -1.09776 0.00165892 AT1G78820 2.2421 1.04589 -1.10012 0.00747871 AT2G42380 2.79474 1.30257 -1.10136 0.00235351 AT1G72490 3.97648 1.85273 -1.10184 0.000896771 AT5G07740 7.09521 3.30307 -1.10304 0.000896771 AT5G38970 2.93327 1.36531 -1.10328 0.000896771 AT4G20820 6.57374 3.05923 -1.10355 0.000896771 AT5G44680 1.71604 0.797286 -1.10591 0.00894171 AT1G78970 1.97141 0.915358 -1.10682 0.000896771 AT5G18670 53.2716 24.7165 -1.10789 0.000896771 AT5G64870 1.44183 0.667203 -1.1117 0.0176581 AT2G45660 20.9995 9.7021 -1.11398 0.000896771 AT3G46900 5.90739 2.72592 -1.11578 0.00533178 AT3G11370 2.2697 1.04639 -1.11709 0.00165892 AT5G42250 57.6608 26.5556 -1.11857 0.000896771 AT1G02640 39.2258 18.0552 -1.11939 0.000896771 AT1G78860 20.7364 9.537 -1.12056 0.000896771 AT4G24340 3.97406 1.826 -1.12193 0.00301378 AT5G28960 1.81725 0.833123 -1.12515 0.0099436 AT2G40750 18.2356 8.35912 -1.12533 0.000896771 AT1G17147 4.59921 2.10699 -1.1262 0.00591387 AT2G41330 4.25023 1.94685 -1.1264 0.000896771 AT1G14540 23.0713 10.5676 -1.12644 0.000896771 AT4G18010 64.8754 29.7068 -1.12688 0.000896771 AT2G30400 2.90393 1.32886 -1.12782 0.00646759 AT2G47810 4.90942 2.24548 -1.12853 0.00646759 AT1G49450 16.9839 7.75458 -1.13105 0.000896771 AT5G52120 4.96186 2.26302 -1.13263 0.000896771 AT2G40340 3.65393 1.66486 -1.13404 0.000896771 AT4G22217 17.4932 7.96979 -1.13418 0.0121949 AT1G35240 1.34603 0.612406 -1.13616 0.0190859 AT1G19960 8.9043 4.04795 -1.13731 0.000896771 AT4G00890 2.48387 1.1257 -1.14177 0.00844354 AT1G65481 4.51559 2.04274 -1.14441 0.00301378 AT5G10230 22.9684 10.3857 -1.14505 0.000896771 AT4G36500 18.8854 8.5253 -1.14745 0.000896771 AT1G20160 16.801 7.58125 -1.14803 0.000896771 AT2G34060 7.40126 3.33972 -1.14804 0.000896771 AT2G46250 1.1429 0.515536 -1.14856 0.0321156 AT1G66540 1.07666 0.485562 -1.14883 0.0279734 AT3G62760 26.3627 11.8882 -1.14897 0.000896771 AT5G64260 112.743 50.832 -1.14923 0.000896771 AT1G13540 1.50092 0.676228 -1.15026 0.049716 AT2G42270 6.57722 2.96129 -1.15125 0.000896771 AT5G62280 18.4868 8.32337 -1.15126 0.000896771 AT1G76720 0.779333 0.350727 -1.15189 0.00798094 AT1G53625 4.49122 2.01609 -1.15555 0.0312181 AT3G27490 1.16922 0.523108 -1.16036 0.00798094 AT1G70080 0.895285 0.399761 -1.16321 0.0296901 AT2G30890 2.08844 0.930865 -1.16578 0.0309397 AT4G12520 182.666 81.3205 -1.16752 0.000896771 AT5G07660 1.18034 0.525417 -1.16766 0.00165892 AT2G03370 4.62013 2.05112 -1.17152 0.000896771 AT4G08780 33.1777 14.723 -1.17215 0.000896771 AT2G13360 7.16669 3.17333 -1.17531 0.000896771 AT4G30270 19.7616 8.73657 -1.17756 0.000896771 AT1G22550 15.4547 6.81803 -1.18062 0.000896771 AT3G13600 13.9826 6.1627 -1.182 0.000896771 AT5G28080 5.5265 2.43504 -1.18242 0.000896771 AT1G55380 4.98636 2.19133 -1.18618 0.000896771 AT2G32340 1.81973 0.799235 -1.18704 0.00844354 AT5G07650 1.98083 0.869655 -1.18759 0.00165892 AT5G52250 8.45062 3.70787 -1.18846 0.000896771 AT1G11460 3.25992 1.42728 -1.19157 0.00363145 AT1G60750 5.05741 2.20913 -1.19492 0.00363145 AT2G31310 5.81833 2.54109 -1.19516 0.0194732 AT1G69150 0.797666 0.348108 -1.19625 0.0391432 AT2G16980 16.8116 7.33667 -1.19626 0.000896771 AT1G27020 21.5122 9.3863 -1.19653 0.000896771 AT5G49360 20.872 9.07392 -1.20177 0.000896771 AT3G62210 11.1099 4.82985 -1.20179 0.000896771 AT1G18870 1.10715 0.480586 -1.20398 0.0216556 AT4G01680 14.2367 6.1792 -1.20413 0.000896771 AT3G12900 14.0792 6.10965 -1.2044 0.000896771 AT2G18800 18.0578 7.81385 -1.20852 0.000896771 AT3G21560 78.4545 33.9472 -1.20856 0.000896771 AT2G26910 4.73163 2.04535 -1.20999 0.000896771 AT1G13550 1.39225 0.601103 -1.21174 0.0406071 AT1G02575 1.72188 0.740213 -1.21797 0.0453182 AT1G50040 2.0219 0.867254 -1.22118 0.00423503 AT3G52540 2.14544 0.919316 -1.22264 0.0237618 AT2G23130 1.94599 0.832042 -1.22578 0.0289973 AT5G48400 0.663342 0.283477 -1.22652 0.0202455 AT5G08350 7.61318 3.25156 -1.22737 0.00165892 AT1G67910 9.75006 4.15344 -1.2311 0.000896771 AT5G17960 1.03511 0.440449 -1.23273 0.028678 AT2G23690 6.52901 2.77165 -1.23612 0.000896771 AT4G36000 1.38257 0.58688 -1.23622 0.0267676 AT1G13480 8.84563 3.74492 -1.24003 0.000896771 AT5G45730 2.77345 1.17337 -1.24102 0.000896771 AT4G26120 2.44431 1.03342 -1.242 0.000896771 AT2G43150 615.65 259.996 -1.24362 0.000896771 AT5G38030 31.692 13.3817 -1.24386 0.000896771 AT1G14185 4.40978 1.85734 -1.24747 0.000896771 AT5G63580 4.74003 1.99547 -1.24817 0.000896771 AT1G05340 10.2936 4.32992 -1.24934 0.000896771 AT1G55700 0.872675 0.366862 -1.25021 0.033388 AT4G22950 4.37225 1.8361 -1.25173 0.0130709 AT3G55290 4.79102 2.00695 -1.25533 0.00165892 AT5G04140 2.99297 1.24953 -1.26019 0.000896771 AT1G31550 1.55584 0.649374 -1.26058 0.0187934 AT3G56000 4.86256 2.02521 -1.26364 0.000896771 AT3G15356 9.33218 3.88352 -1.26485 0.000896771 AT4G21326 1.8606 0.774087 -1.2652 0.000896771 AT1G25450 7.02432 2.92142 -1.26569 0.000896771 AT4G19720 11.7199 4.86216 -1.26929 0.000896771 AT1G48870 0.766836 0.318005 -1.26987 0.0289973 AT1G16370 7.35397 3.047 -1.27113 0.000896771 AT3G05900 90.3973 37.3164 -1.27647 0.000896771 AT3G22400 7.27578 2.99433 -1.28087 0.000896771 AT4G20450 3.33584 1.37245 -1.2813 0.000896771 AT3G26610 9.53739 3.91171 -1.2858 0.000896771 AT4G29270 80.6892 33.0758 -1.2866 0.000896771 AT4G29050 0.572759 0.23406 -1.29105 0.049716 AT2G45220 157.629 64.3322 -1.29292 0.000896771 AT3G48940 6.76903 2.7616 -1.29344 0.000896771 AT1G52190 2.27527 0.926925 -1.29552 0.000896771 AT2G18120 2.17714 0.885409 -1.29802 0.00798094 AT2G25510 4.17939 1.69724 -1.3001 0.0112625 AT2G35340 2.46013 0.997609 -1.30219 0.000896771 AT5G20790 16.8682 6.80534 -1.30956 0.00479593 AT5G40450 53.6909 21.6602 -1.30963 0.000896771 AT3G47760 1.05539 0.425295 -1.31124 0.00479593 AT3G05860 2.08493 0.840067 -1.31142 0.0303132 AT1G72890 4.19874 1.68885 -1.31392 0.000896771 AT1G13420 30.7742 12.3729 -1.31454 0.000896771 AT1G53990 2.9804 1.1963 -1.31693 0.00697391 AT1G51260 1.99199 0.796316 -1.3228 0.00533178 AT1G22530 119.448 47.6611 -1.3255 0.000896771 AT2G22330 60.5544 24.1557 -1.32586 0.000896771 AT4G22212 135.448 54.008 -1.3265 0.000896771 AT4G18197 2.49403 0.992947 -1.32869 0.000896771 AT1G10300 1.69411 0.673397 -1.331 0.000896771 AT1G49920 0.502217 0.198167 -1.3416 0.0312181 AT3G20520 0.630252 0.246868 -1.35219 0.0450489 AT1G60260 0.88542 0.345967 -1.35573 0.043471 AT1G45191 0.842741 0.328754 -1.35808 0.0187934 AT4G10500 6.50675 2.53511 -1.35989 0.000896771 AT5G20410 2.10845 0.819628 -1.36314 0.00165892 AT5G38410 2.37735 0.92203 -1.36647 0.00646759 AT4G11211 36.4213 14.0909 -1.37001 0.000896771 AT5G10100 28.9554 11.202 -1.37008 0.000896771 AT5G44050 2.33548 0.903159 -1.37067 0.000896771 AT5G66800 2.0002 0.773476 -1.37072 0.0168811 AT5G14340 10.7714 4.16361 -1.37129 0.000896771 AT5G17780 4.49545 1.73718 -1.37172 0.000896771 AT4G15150 6.39842 2.46829 -1.3742 0.0455702 AT3G02140 28.055 10.8112 -1.37573 0.000896771 AT4G13130 5.71169 2.19257 -1.3813 0.000896771 AT2G04500 2.55874 0.977633 -1.38807 0.000896771 AT5G23750 21.7721 8.31835 -1.38811 0.000896771 AT5G18930 2.1325 0.814569 -1.38844 0.00301378 AT4G13340 26.3838 10.058 -1.39131 0.000896771 AT1G53430 17.4945 6.66805 -1.39157 0.000896771 AT4G25100 165.702 63.0295 -1.39449 0.000896771 AT5G28610 8.20589 3.11932 -1.39543 0.000896771 AT4G37410 468.736 178.069 -1.39634 0.000896771 AT4G39030 19.7527 7.48446 -1.40008 0.000896771 AT2G25160 19.0406 7.21079 -1.40085 0.000896771 AT1G64160 6.33686 2.3903 -1.40658 0.00301378 AT1G21230 2.01267 0.758938 -1.40705 0.000896771 AT3G04220 1.63422 0.616171 -1.4072 0.000896771 AT3G46880 7.17512 2.70438 -1.4077 0.0251315 AT1G31710 18.5355 6.98562 -1.40783 0.000896771 AT2G39040 34.3996 12.9021 -1.41478 0.000896771 AT1G75550 3.68131 1.38018 -1.41536 0.0121949 AT5G26120 1.28726 0.4825 -1.41571 0.00844354 AT1G03870 314.976 118.033 -1.41605 0.000896771 AT1G18570 8.32972 3.11861 -1.41736 0.000896771 AT3G50150 2.89248 1.08244 -1.41803 0.000896771 AT1G21130 9.59747 3.58351 -1.42128 0.000896771 AT1G19250 7.5219 2.80538 -1.4229 0.000896771 AT3G50140 2.18933 0.814507 -1.42649 0.000896771 AT1G35910 5.41843 2.01246 -1.42891 0.000896771 AT1G19390 0.735356 0.272078 -1.43442 0.0139458 AT5G63160 93.8945 34.7308 -1.43482 0.000896771 AT4G16860 0.705383 0.260828 -1.43531 0.00423503 AT1G14960 15.9358 5.88617 -1.43687 0.000896771 AT3G53960 0.905984 0.334018 -1.43956 0.0121949 AT4G16980 19.1412 7.03903 -1.44324 0.000896771 AT2G29130 2.93957 1.08006 -1.4445 0.000896771 AT2G16970 4.7683 1.75185 -1.4446 0.000896771 AT2G01530 386.794 142.01 -1.44557 0.000896771 AT4G26320 194.497 71.2306 -1.44918 0.000896771 AT3G59370 111.089 40.389 -1.45968 0.000896771 AT3G45330 3.02675 1.09886 -1.46175 0.000896771 AT1G49200 3.76736 1.36388 -1.46584 0.00363145 AT1G22330 11.6486 4.21667 -1.46598 0.000896771 AT4G22666 118.781 42.8581 -1.47067 0.000896771 AT1G66725 71.0935 25.6296 -1.47191 0.00235351 AT1G19540 5.9927 2.15546 -1.47521 0.000896771 AT3G28580 5.80556 2.08665 -1.47625 0.000896771 AT1G62510 9.15552 3.2896 -1.47673 0.000896771 AT4G14640 12.9864 4.66501 -1.47705 0.000896771 AT5G63450 3.01987 1.08102 -1.48209 0.000896771 AT5G62100 2.99275 1.06718 -1.48767 0.000896771 AT1G52410 3.33778 1.18946 -1.48859 0.000896771 AT1G73280 11.0732 3.94567 -1.48874 0.000896771 AT4G37390 10.5249 3.745 -1.49077 0.000896771 AT1G21110 69.8424 24.8365 -1.49164 0.000896771 AT4G18422 5.0409 1.79216 -1.49198 0.0485303 AT5G12280 1.78503 0.633765 -1.49393 0.00533178 AT1G72540 0.940722 0.333261 -1.49712 0.0439757 AT1G78020 45.7254 16.1622 -1.50037 0.000896771 AT5G53380 5.3311 1.8817 -1.5024 0.000896771 AT1G21120 34.262 12.0677 -1.50546 0.000896771 AT4G12510 38.5173 13.4738 -1.51534 0.000896771 AT2G18480 1.28895 0.449221 -1.5207 0.00423503 AT1G62500 6.88794 2.39162 -1.52609 0.000896771 AT2G31081 5.35197 1.85707 -1.52705 0.0099436 AT3G16400 424.857 147.013 -1.53103 0.000896771 AT2G32140 1.23578 0.427538 -1.5313 0.0161065 AT4G11170 0.917785 0.31748 -1.53149 0.00165892 AT1G24020 2.13729 0.739153 -1.53184 0.0190859 AT5G38000 5.81229 2.00773 -1.53355 0.000896771 AT1G68620 2.08098 0.717756 -1.53569 0.00165892 AT2G18210 9.57188 3.29278 -1.5395 0.000896771 AT4G05100 4.07493 1.39169 -1.54994 0.000896771 AT1G62975 18.259 6.19289 -1.55992 0.000896771 AT5G22300 1.57339 0.532582 -1.5628 0.00301378 AT1G58602 0.808918 0.273522 -1.56434 0.000896771 AT1G13670 41.562 14.0328 -1.56646 0.000896771 AT5G03960 13.0101 4.38168 -1.57007 0.000896771 AT2G24270 3.00002 1.01012 -1.57044 0.000896771 AT1G02670 0.686867 0.231192 -1.57094 0.00946099 AT2G23170 3.38372 1.13405 -1.57713 0.000896771 AT4G08040 1.8214 0.609689 -1.5789 0.000896771 AT4G22460 66.2697 22.145 -1.58137 0.000896771 AT5G66640 1.05746 0.35311 -1.58241 0.00165892 AT2G31070 1.87217 0.624153 -1.58474 0.000896771 AT5G47990 21.5162 7.16767 -1.58585 0.000896771 AT3G48350 10.7033 3.56354 -1.58667 0.000896771 AT5G41750 3.32985 1.10635 -1.58965 0.000896771 AT5G49620 1.5564 0.515675 -1.59368 0.0103576 AT4G28940 47.6088 15.7383 -1.59695 0.000896771 AT4G18510 15.6233 5.15711 -1.59907 0.000896771 AT3G28750 1.02179 0.337099 -1.59986 0.0327554 AT1G72900 6.02239 1.98606 -1.60042 0.000896771 AT5G39670 17.7595 5.82542 -1.60816 0.000896771 AT3G29250 146.759 48.0502 -1.61083 0.000896771 AT2G38152 1.41726 0.457612 -1.6309 0.0248346 AT2G41312 4.40098 1.4166 -1.63539 0.0339736 AT3G26330 20.392 6.55262 -1.63786 0.000896771 AT1G19900 37.2901 11.9784 -1.63836 0.000896771 AT3G51075 1.33986 0.428462 -1.64484 0.000896771 AT5G20860 6.63903 2.11071 -1.65324 0.000896771 AT5G54490 6.3943 2.02546 -1.65854 0.000896771 AT4G25410 3.28493 1.04033 -1.65882 0.000896771 AT1G29910 3.96484 1.25249 -1.66246 0.000896771 AT1G64310 0.622088 0.195659 -1.66878 0.0464006 AT4G13230 2.14353 0.674179 -1.66879 0.0414092 AT5G56840 1.83413 0.576089 -1.67073 0.0103576 AT5G22555 7.64534 2.39711 -1.67328 0.00235351 AT1G06120 19.4033 6.0816 -1.67378 0.000896771 AT1G69920 7.20152 2.25053 -1.67804 0.000896771 AT5G61890 1.01327 0.31598 -1.68112 0.0309397 AT5G24570 19.0273 5.92396 -1.68343 0.000896771 AT4G28350 1.13104 0.350556 -1.68993 0.00165892 AT1G62540 2.35514 0.729427 -1.69098 0.000896771 AT2G18550 3.57062 1.10552 -1.69146 0.000896771 AT5G03435 0.583667 0.18041 -1.69387 0.0216556 AT5G47240 3.49919 1.0761 -1.7012 0.000896771 AT1G12080 229.121 70.1138 -1.70834 0.000896771 AT4G22690 7.27917 2.22374 -1.71079 0.000896771 AT4G22110 9.05939 2.76538 -1.71193 0.000896771 AT3G28740 41.1725 12.5465 -1.71439 0.00301378 AT3G60470 0.656182 0.19921 -1.7198 0.0330857 AT1G70890 17.5535 5.31266 -1.72426 0.000896771 AT3G15450 264.525 79.8862 -1.72739 0.000896771 AT1G75750 603.25 181.781 -1.73056 0.000896771 AT1G26250 160.609 48.3843 -1.73094 0.000896771 AT5G53250 120.315 35.5588 -1.75854 0.000896771 AT5G33355 72.7812 21.4536 -1.76235 0.000896771 AT2G18300 1.01692 0.299033 -1.76582 0.00798094 AT5G60660 88.6445 25.97 -1.77118 0.000896771 AT4G17340 310.077 90.7309 -1.77296 0.000896771 AT2G39310 116.492 34.0405 -1.7749 0.000896771 AT1G71695 35.0915 10.2045 -1.78191 0.000896771 AT3G46400 3.27478 0.951301 -1.78342 0.000896771 AT5G50140 1.4948 0.43325 -1.78668 0.00301378 AT2G03530 2.33106 0.673221 -1.79184 0.000896771 AT5G57220 13.8957 3.99462 -1.7985 0.000896771 AT5G11920 15.145 4.3485 -1.80025 0.000896771 AT5G64110 4.17527 1.19437 -1.80562 0.000896771 AT4G36230 1.06059 0.302881 -1.80805 0.0445386 AT4G11210 26.0816 7.41733 -1.81406 0.000896771 AT3G29410 22.6118 6.41094 -1.81847 0.000896771 AT4G23670 349.64 98.7832 -1.82353 0.000896771 AT3G58000 4.68658 1.31922 -1.82885 0.000896771 AT4G15480 18.904 5.31598 -1.83028 0.000896771 AT5G44130 37.4048 10.4524 -1.83939 0.000896771 AT1G18140 13.7623 3.84363 -1.84018 0.000896771 AT4G18250 3.30748 0.922118 -1.84271 0.000896771 AT3G23060 0.485272 0.134675 -1.84931 0.0419469 AT5G41080 44.7728 12.3855 -1.85397 0.000896771 AT3G16690 15.9829 4.39634 -1.86216 0.000896771 AT1G74890 1.1991 0.327212 -1.87365 0.035176 AT3G11385 1.3526 0.368598 -1.87561 0.000896771 AT4G01140 12.0032 3.25613 -1.88219 0.000896771 AT3G24480 51.3725 13.8496 -1.89116 0.000896771 AT5G14920 17.2898 4.65532 -1.89297 0.000896771 AT3G50560 1.8188 0.487341 -1.89999 0.00235351 AT1G77530 13.1983 3.51094 -1.91042 0.0176581 AT4G36410 24.0411 6.37042 -1.91604 0.000896771 AT5G60060 3.53907 0.937478 -1.91651 0.000896771 AT1G10385 1.46381 0.387341 -1.91805 0.000896771 AT1G26200 3.33482 0.874649 -1.93083 0.000896771 AT3G25820 1.11496 0.291419 -1.93583 0.0176581 AT4G11880 20.5533 5.31557 -1.95108 0.000896771 AT3G17690 1.86441 0.481627 -1.95273 0.000896771 AT5G54700 14.3204 3.67586 -1.96192 0.000896771 AT5G60900 0.825485 0.211678 -1.96337 0.000896771 AT1G28170 6.19711 1.58328 -1.96868 0.000896771 AT1G03010 2.97882 0.760571 -1.96959 0.000896771 AT4G28840 6.81151 1.72822 -1.97869 0.000896771 AT4G37235 1.92786 0.489029 -1.97901 0.0209346 AT3G46490 1.05437 0.267382 -1.9794 0.0099436 AT5G01900 2.27862 0.577206 -1.981 0.00363145 AT4G18390 9.25163 2.33961 -1.98344 0.000896771 AT1G22890 2.50783 0.633406 -1.98524 0.0267676 AT1G73330 622.103 156.871 -1.98758 0.000896771 AT4G14060 24.696 6.21508 -1.99043 0.000896771 AT3G61060 24.2398 6.06317 -1.99924 0.0466807 AT1G56240 2.21092 0.551891 -2.00219 0.000896771 AT1G70850 989.287 244.716 -2.01528 0.000896771 AT3G51680 4.65344 1.12646 -2.0465 0.000896771 AT1G71050 1.84163 0.442883 -2.05599 0.0103576 AT4G04840 12.9947 3.11751 -2.05945 0.000896771 AT5G46900 138.875 33.0588 -2.07068 0.000896771 AT3G30260 3.14812 0.743435 -2.08221 0.000896771 AT2G34490 6.38583 1.50697 -2.08322 0.000896771 AT3G26460 28.9313 6.76231 -2.09704 0.000896771 AT4G08300 40.2714 9.3248 -2.11061 0.000896771 AT4G04990 10.2482 2.36517 -2.11536 0.000896771 AT3G29430 6.28191 1.4424 -2.12274 0.000896771 AT3G16390 32.3649 7.40868 -2.12714 0.000896771 AT5G38980 4.29683 0.972718 -2.14318 0.00423503 AT4G25830 5.39441 1.22081 -2.14362 0.000896771 AT2G21650 3.99645 0.900996 -2.14913 0.000896771 AT5G12270 3.78701 0.85146 -2.15305 0.000896771 AT3G21080 1.24525 0.279187 -2.15714 0.0165092 AT1G57980 2.01566 0.450173 -2.1627 0.000896771 AT5G37990 40.4687 8.93668 -2.179 0.000896771 AT1G23760 5.43577 1.20009 -2.17934 0.000896771 AT3G21340 8.19195 1.78933 -2.19479 0.000896771 AT5G26920 6.15703 1.33886 -2.20123 0.000896771 AT1G12010 73.3477 15.9082 -2.20499 0.000896771 AT2G33830 135.659 29.4183 -2.20519 0.000896771 AT3G16240 256.256 55.2708 -2.213 0.000896771 AT1G61130 4.18809 0.893516 -2.22873 0.000896771 AT4G15290 28.6079 6.07474 -2.23552 0.000896771 AT1G70985 2.55222 0.537379 -2.24774 0.0391432 AT3G11390 0.886089 0.18654 -2.24797 0.00423503 AT5G51790 2.57605 0.528745 -2.28452 0.000896771 AT1G06830 11.7534 2.40749 -2.28748 0.000896771 AT3G59340 3.49021 0.710079 -2.29726 0.000896771 AT5G23980 0.525909 0.106593 -2.3027 0.0148175 AT4G22710 5.24299 1.06066 -2.30543 0.000896771 AT1G78450 2.8771 0.577951 -2.3156 0.000896771 AT5G04370 1.18708 0.233807 -2.34402 0.000896771 AT4G23680 26.2464 5.14103 -2.35199 0.000896771 AT5G05340 8.50595 1.6483 -2.36749 0.000896771 AT3G60120 0.712946 0.136512 -2.38476 0.00747871 AT1G66970 0.485219 0.0921853 -2.39603 0.00894171 AT4G23700 6.45873 1.18958 -2.4408 0.000896771 AT3G18450 31.3012 5.4788 -2.51429 0.000896771 AT1G13710 4.38306 0.75981 -2.52823 0.000896771 AT5G51780 32.0999 5.50473 -2.54383 0.000896771 AT4G39770 5.72463 0.973762 -2.55554 0.000896771 AT5G64810 10.2654 1.74146 -2.55943 0.000896771 AT4G11320 370.462 61.4138 -2.59269 0.000896771 AT5G54720 0.7693 0.127408 -2.59409 0.0384078 AT3G13840 2.73016 0.447876 -2.60781 0.000896771 AT5G54710 3.21266 0.524289 -2.61533 0.000896771 AT2G41100 77.8752 12.6811 -2.61849 0.000896771 AT3G45700 20.2264 3.2776 -2.62553 0.000896771 AT5G38940 103.748 16.7204 -2.6334 0.000896771 AT3G44860 0.603237 0.0943789 -2.67619 0.0485303 AT3G47480 2.43029 0.377811 -2.68539 0.00235351 AT2G20080 6.18746 0.955417 -2.69514 0.000896771 AT3G56400 5.75151 0.884097 -2.70166 0.000896771 AT3G45680 4.5701 0.694792 -2.71757 0.000896771 AT1G77520 11.5602 1.74004 -2.73197 0.000896771 AT1G72140 9.82236 1.46544 -2.74473 0.000896771 AT4G00780 2.66666 0.38582 -2.78904 0.000896771 AT5G38020 32.5376 4.70531 -2.78975 0.000896771 AT1G21530 1.06551 0.153732 -2.79305 0.00235351 AT1G26410 1.46879 0.210714 -2.80127 0.000896771 AT5G24200 1.24695 0.175118 -2.83201 0.00423503 AT5G44585 7.96321 1.11116 -2.84128 0.000896771 AT1G14120 20.1871 2.79313 -2.85348 0.000896771 AT2G39400 1.9483 0.269375 -2.85452 0.00165892 AT1G76210 2.10015 0.288396 -2.86437 0.00646759 AT4G37950 1.05964 0.144505 -2.87438 0.000896771 AT1G17300 22.8158 3.11131 -2.87444 0.000896771 AT1G21100 15.923 2.17009 -2.87528 0.000896771 AT5G36140 1.50124 0.203234 -2.88494 0.0257703 AT5G46890 211.427 27.9503 -2.91923 0.000896771 AT4G19925 1.36043 0.178519 -2.92992 0.0389047 AT5G52710 2.3847 0.31226 -2.93299 0.000896771 AT4G37700 10.1974 1.31003 -2.96053 0.000896771 AT5G47450 53.4383 6.66691 -3.00278 0.000896771 AT2G26400 11.1755 1.38262 -3.01486 0.000896771 AT4G15990 5.92926 0.716907 -3.048 0.000896771 AT2G24130 0.484256 0.0538481 -3.1688 0.00844354 AT1G69930 1.35175 0.147411 -3.19691 0.0244475 AT3G62960 3.27928 0.348214 -3.23533 0.0264303 AT2G40250 1.07314 0.113284 -3.24382 0.0391432 AT4G01890 1.01974 0.102968 -3.30793 0.0283563 AT1G56250 2.09118 0.203798 -3.3591 0.00363145 AT5G17700 3.90463 0.360934 -3.43538 0.000896771 AT5G24780 10.451 0.944566 -3.46785 0.000896771 AT4G09200 2.41989 0.21475 -3.49421 0.000896771 AT1G26240 2.6938 0.23362 -3.52741 0.000896771 AT1G24485 1.14875 0.0990873 -3.53522 0.00363145 AT1G16390 4.55123 0.389575 -3.54628 0.000896771 AT2G27402 6.61252 0.55297 -3.57993 0.000896771 AT3G50160 1.22715 0.0947876 -3.69446 0.00423503 AT1G26380 8.4817 0.653214 -3.69873 0.000896771 AT2G24850 3.39899 0.256779 -3.7265 0.000896771 AT2G30750 46.0334 3.20153 -3.84585 0.000896771 AT3G60415 4.30318 0.273683 -3.97483 0.00165892 AT1G01680 4.39652 0.27139 -4.01793 0.000896771 AT5G13320 2.90082 0.16947 -4.09736 0.000896771 AT3G22250 2.01259 0.111865 -4.16922 0.00894171 AT5G38910 4.30528 0.204085 -4.39886 0.00479593 AT1G52800 4.23554 0.191449 -4.46751 0.000896771 AT1G58320 5.78791 0.217586 -4.73339 0.0324105 AT2G01520 632.342 21.7624 -4.8608 0.000896771 AT1G52820 33.7889 1.12434 -4.9094 0.000896771 AT5G24770 24.2442 0.787064 -4.94501 0.000896771 AT1G62280 3.5413 0.113999 -4.95718 0.00894171 AT1G26390 14.7554 0.211076 -6.12734 0.000896771 **Table S4. List of salt-responsive differentially expressed genes in the roots of** _**uri-2**_ **mutant.** **gene_id** **ES_uri_root** **NaCl_uri_root** **log2(NaCl/ES)** **q_value** AT3G49620 0.452598 56.4743 6.96322 0.000523725 AT2G24560 0.0705055 2.0587 4.86786 0.022458 AT2G04050 0.0800128 2.27861 4.83178 0.00330941 AT5G13370 0.657148 12.448 4.24355 0.000523725 AT4G15100 0.110817 2.0741 4.22623 0.000986217 AT4G15370 0.945479 14.3571 3.92457 0.000523725 AT4G13420 7.51072 104.897 3.80388 0.000523725 AT2G28860 0.0823678 1.02645 3.63945 0.00991024 AT5G28510 0.753772 9.29376 3.62406 0.000523725 AT4G22610 1.35524 16.5519 3.61038 0.000523725 AT3G56350 0.684639 8.32223 3.60355 0.000523725 AT2G26560 3.69166 43.5862 3.56153 0.000523725 AT2G05510 52.9958 600.608 3.50247 0.000523725 AT5G61740 0.0401518 0.454208 3.49982 0.00295584 AT2G17660 2.31216 24.5726 3.40974 0.000523725 AT1G08440 0.260893 2.74148 3.39342 0.000523725 AT3G27250 0.0510466 0.515241 3.33536 0.0307839 AT4G18280 8.49758 80.0686 3.23611 0.000523725 AT4G13310 0.285178 2.56067 3.16659 0.000523725 AT5G50550 0.330598 2.90122 3.13351 0.000523725 AT5G24640 0.863732 7.33235 3.08562 0.00181778 AT1G52120 0.053361 0.439912 3.04336 0.0436332 AT3G03670 2.08191 16.7166 3.0053 0.000523725 AT2G29470 0.269353 2.12979 2.98314 0.000523725 AT2G22860 11.0846 86.4775 2.96377 0.000523725 AT5G38100 1.29504 9.93539 2.93958 0.000523725 AT1G76470 0.36712 2.81377 2.93818 0.000523725 AT5G01380 0.415945 3.18571 2.93715 0.000523725 AT1G02850 7.26006 54.6877 2.91316 0.000523725 AT1G52400 0.293357 2.17433 2.88984 0.000523725 AT3G23240 0.60732 4.41139 2.86071 0.000523725 AT4G33720 82.7116 589.135 2.83244 0.000523725 AT2G47190 0.130922 0.904731 2.78878 0.0258728 AT5G14360 2.10333 14.1062 2.74558 0.000523725 AT4G06746 2.77288 17.7864 2.68132 0.000523725 AT2G27535 2.42157 15.4842 2.67678 0.000523725 AT1G71140 0.389522 2.48859 2.67555 0.000523725 AT3G44290 0.373318 2.36585 2.66388 0.000523725 AT4G12735 1.29455 8.07603 2.64119 0.000523725 AT5G43570 0.797727 4.96733 2.6385 0.00435758 AT1G21340 1.07366 6.59215 2.61821 0.000523725 AT2G30766 2.50679 15.2755 2.60731 0.000523725 AT4G15280 0.514985 3.10605 2.59248 0.000523725 AT4G31330 7.53308 45.303 2.58829 0.000523725 AT5G25190 2.28115 13.6582 2.58193 0.000523725 AT1G30220 0.109096 0.651351 2.57784 0.00844927 AT1G49570 33.1356 197.402 2.57469 0.000523725 AT2G28850 0.888797 5.18512 2.54445 0.000523725 AT3G17010 0.289962 1.69097 2.54391 0.00295584 AT1G22210 0.117509 0.682409 2.53787 0.041953 AT1G61750 1.3009 7.45575 2.51884 0.000523725 AT3G05770 1.32716 7.60478 2.51857 0.0158107 AT1G32960 0.172265 0.981916 2.51097 0.00365889 AT1G69880 28.7696 163.324 2.50512 0.000523725 AT5G47220 4.7845 25.5743 2.41826 0.000523725 AT2G34930 3.12222 16.4825 2.40029 0.000523725 AT1G50960 0.298919 1.54134 2.36636 0.00295584 AT5G23660 0.402636 2.06607 2.35934 0.000523725 AT1G33030 0.848022 4.31854 2.34837 0.000523725 AT4G15350 2.56318 13.0112 2.34375 0.000523725 AT5G24140 0.615745 3.12471 2.34332 0.000523725 AT5G03210 0.494465 2.49636 2.33589 0.0443006 AT3G19200 5.9702 29.9506 2.32674 0.000523725 AT4G38410 7.86118 39.3771 2.32454 0.000523725 AT1G52855 0.321808 1.60638 2.31954 0.0229574 AT1G77380 15.8689 78.6877 2.30993 0.000523725 AT1G64110 1.5227 7.35354 2.27181 0.000523725 AT1G76410 3.56784 17.1745 2.26715 0.000523725 AT2G05520 4.72726 22.498 2.25072 0.000523725 AT1G12890 0.394714 1.86389 2.23944 0.0258728 AT3G10930 6.58818 30.4313 2.2076 0.000523725 AT4G36110 0.882669 4.05122 2.19841 0.000523725 AT3G44840 0.442554 2.02517 2.19412 0.00435758 AT4G21680 15.3622 70.2699 2.19352 0.000523725 AT2G40520 0.161749 0.730435 2.175 0.0014071 AT1G64160 9.2633 41.8028 2.174 0.000523725 AT3G53160 0.472872 2.10025 2.15104 0.000523725 AT3G44300 44.7045 196.233 2.13408 0.000523725 AT4G28170 1.30484 5.71513 2.13091 0.0450427 AT5G36925 1.10761 4.82905 2.12429 0.000523725 AT1G69490 2.28966 9.93452 2.11731 0.000523725 AT1G63055 3.93263 16.9892 2.11106 0.000523725 AT4G22470 7.86692 33.9286 2.10863 0.000523725 AT5G13220 1.15461 4.95083 2.10026 0.000523725 AT1G75250 1.77211 7.59054 2.09873 0.000523725 AT2G43510 2.90446 12.4147 2.09571 0.000523725 AT5G59320 26.9604 115.199 2.09522 0.000523725 AT5G55270 0.206771 0.881103 2.09128 0.0121826 AT1G55200 0.472293 1.97767 2.06605 0.0163386 AT2G32460 0.189814 0.793553 2.06374 0.00534991 AT5G01215 7.17733 29.8927 2.05827 0.0402938 AT3G28540 0.709913 2.93891 2.04957 0.000523725 AT3G48510 0.395911 1.63578 2.04673 0.00222163 AT2G17780 0.154984 0.63496 2.03454 0.0014071 AT5G06860 54.1689 221.4 2.03112 0.000523725 AT3G15500 1.50829 6.15962 2.02993 0.000523725 AT1G30660 0.364972 1.48745 2.02698 0.00365889 AT5G55110 8.1993 33.2192 2.01844 0.000523725 AT2G26740 1.35365 5.46727 2.01397 0.000523725 AT1G51820 0.786005 3.17288 2.01318 0.000523725 AT3G04320 33.2313 132.949 2.00025 0.000523725 AT1G64660 4.1988 16.7486 1.99599 0.000523725 AT4G16260 297.835 1186.57 1.99422 0.000523725 AT2G37870 3.74905 14.9298 1.9936 0.000523725 AT2G19900 0.456265 1.81336 1.99072 0.000523725 AT4G34380 0.912771 3.61618 1.98614 0.000523725 AT5G07200 0.875905 3.46783 1.98519 0.000523725 AT5G19110 8.23675 32.5319 1.98171 0.000523725 AT5G13330 12.3706 48.7434 1.97829 0.000523725 AT1G30560 0.192196 0.756909 1.97754 0.00991024 AT3G02480 1.36861 5.34603 1.96576 0.00330941 AT4G29305 1.61195 6.2816 1.96232 0.0116163 AT1G07367 4.81454 18.7438 1.96094 0.000523725 AT4G11650 426.325 1657.31 1.95881 0.000523725 AT3G62990 0.492685 1.90996 1.95481 0.0227018 AT1G32510 0.85947 3.32568 1.95213 0.000523725 AT1G53130 11.6467 45.0212 1.95069 0.000523725 AT1G02820 0.786016 3.01743 1.94069 0.00365889 AT1G71890 0.130758 0.501841 1.94033 0.031381 AT5G64450 0.703513 2.69125 1.93563 0.0392003 AT5G36220 1.81182 6.91553 1.9324 0.000523725 AT5G43870 1.34909 5.13355 1.92797 0.000523725 AT2G38250 1.21828 4.62039 1.92316 0.000523725 AT1G36180 2.25835 8.55184 1.92097 0.000523725 AT1G48325 2.19533 8.23489 1.90731 0.00598846 AT2G27550 61.6118 229.737 1.8987 0.000523725 AT2G38530 26.7836 99.8626 1.8986 0.000523725 AT1G62290 0.501761 1.86172 1.89157 0.000523725 AT4G16690 0.245876 0.91169 1.89061 0.0110551 AT1G04370 1.23194 4.5639 1.88933 0.000523725 AT3G53720 0.187293 0.69204 1.88556 0.000986217 AT3G24310 1.22386 4.52188 1.88549 0.000523725 AT5G45350 54.7397 202.136 1.88467 0.000523725 AT1G34047 4.45849 16.4464 1.88315 0.000523725 AT3G11260 1.25865 4.63762 1.88151 0.000523725 AT5G11410 0.18614 0.685172 1.88008 0.0256422 AT4G16370 22.9523 84.3306 1.87741 0.000523725 AT1G56430 14.8032 54.3677 1.87684 0.000523725 AT1G54950 0.998054 3.61031 1.85494 0.00435758 AT3G60090 0.920789 3.31915 1.84987 0.000986217 AT3G50310 0.156167 0.55581 1.83151 0.0481224 AT1G27730 18.0885 64.3662 1.83123 0.000523725 AT2G43580 1.26231 4.48911 1.83037 0.000523725 AT3G03660 1.76736 6.28043 1.82926 0.000523725 AT2G39800 13.8155 48.8888 1.82322 0.000523725 AT2G20800 0.474251 1.67474 1.82022 0.000523725 AT5G01775 0.77324 2.72765 1.81867 0.0165975 AT5G59060 1.1186 3.94551 1.81852 0.0368736 AT1G08973 2.40678 8.48603 1.81798 0.0332044 AT2G43610 206.844 725.773 1.81098 0.000523725 AT5G57390 0.918995 3.21606 1.80716 0.000523725 AT3G48580 0.569111 1.97505 1.79511 0.000523725 AT5G10180 3.96567 13.7415 1.79291 0.000523725 AT4G02330 15.5193 53.5557 1.78698 0.000523725 AT4G12490 91.9526 315.404 1.77824 0.000523725 AT4G37060 0.368703 1.26437 1.77789 0.0014071 AT3G59140 3.84817 13.1555 1.77342 0.000523725 AT2G36270 0.899137 3.03959 1.75726 0.000523725 AT1G67470 0.564912 1.90648 1.75481 0.000523725 AT5G05250 2.91103 9.77913 1.74818 0.000523725 AT5G42680 0.472878 1.5882 1.74785 0.0101982 AT1G26770 7.38162 24.7282 1.74415 0.000523725 AT1G64970 1.34935 4.51167 1.7414 0.0176477 AT5G13210 3.30743 11.0566 1.74112 0.000523725 AT1G14520 1.01385 3.36273 1.72979 0.000523725 AT4G26880 2.49476 8.26925 1.72885 0.000523725 AT1G67105 3.48557 11.5075 1.72311 0.000523725 AT2G43870 3.82329 12.5944 1.7199 0.000523725 AT3G04720 361.809 1191.01 1.71888 0.000523725 AT1G26240 1.38452 4.55589 1.71834 0.000523725 AT2G41905 0.606125 1.99243 1.71684 0.0298501 AT3G09400 0.205965 0.674741 1.71193 0.00724764 AT1G73260 92.3642 301.65 1.70747 0.000523725 AT1G17960 1.64308 5.35281 1.70389 0.000523725 AT1G71380 1.6116 5.24943 1.70367 0.000523725 AT3G30725 2.22461 7.23073 1.70059 0.000986217 AT1G15010 5.54951 17.9861 1.69645 0.000523725 AT5G35770 0.401836 1.29931 1.69307 0.00259159 AT2G21780 0.356252 1.15051 1.6913 0.0374873 AT3G25420 0.171532 0.553256 1.68947 0.0494519 AT1G19180 29.5189 95.0288 1.68673 0.000523725 AT4G26200 2.78795 8.97118 1.68609 0.000523725 AT4G24570 15.0427 48.3163 1.68345 0.000523725 AT1G16410 0.17774 0.570726 1.68303 0.0165975 AT2G23970 0.470869 1.51192 1.68298 0.0336076 AT5G51920 1.90963 6.12649 1.68177 0.000523725 AT3G22120 11.9974 38.3159 1.67522 0.000523725 AT3G56980 5.07046 16.1443 1.67083 0.000523725 AT3G14210 0.443684 1.40788 1.66592 0.000986217 AT5G43450 0.810733 2.55091 1.65371 0.000523725 AT4G01360 1.24337 3.90712 1.65185 0.000523725 AT3G29810 5.76457 18.1084 1.65137 0.000523725 AT2G26370 3.22466 10.1267 1.65095 0.000523725 AT1G65860 1.05742 3.31444 1.64821 0.000523725 AT1G18100 6.91412 21.6678 1.64794 0.000523725 AT4G31800 7.38383 23.0983 1.64535 0.000523725 AT2G35612 1.384 4.32648 1.64435 0.00259159 AT5G67080 0.820704 2.55238 1.63691 0.00844927 AT3G01970 4.5518 14.1121 1.63243 0.000523725 AT2G32210 6.83582 21.1876 1.63203 0.000523725 AT5G24070 11.9785 37.1025 1.63108 0.000523725 AT2G13610 0.700237 2.15941 1.62472 0.000523725 AT4G29780 6.35925 19.5421 1.61966 0.000523725 AT1G54575 21.3883 65.7203 1.61952 0.000523725 AT4G00165 1.8638 5.7222 1.61832 0.000986217 AT5G48010 20.0616 61.5203 1.61663 0.000523725 AT5G59340 0.355385 1.08581 1.61131 0.0181532 AT1G16850 18.5204 56.5425 1.61022 0.000523725 AT5G22580 3.01202 9.18522 1.60858 0.000523725 AT3G54800 0.217145 0.660302 1.60446 0.00400116 AT3G48850 1.04048 3.16305 1.60406 0.000523725 AT2G19650 0.176755 0.536797 1.60263 0.0168598 AT2G18193 10.3414 31.2683 1.59627 0.000523725 AT5G39610 6.17654 18.6052 1.59083 0.000523725 AT3G47800 18.4541 55.4912 1.58832 0.000523725 AT5G51810 1.03972 3.10042 1.57627 0.000523725 AT5G59070 2.28932 6.80189 1.57101 0.000523725 AT1G29090 0.288965 0.857776 1.56971 0.0289052 AT1G44010 2.12513 6.30462 1.56886 0.000523725 AT4G34970 3.59514 10.6634 1.56854 0.000523725 AT4G25310 21.0314 62.2869 1.56638 0.000523725 AT2G02930 0.530364 1.56846 1.5643 0.0138333 AT1G65730 3.71565 10.9873 1.56415 0.000523725 AT2G14210 2.47913 7.32884 1.56375 0.000523725 AT5G45080 6.47362 19.0318 1.55577 0.000523725 AT5G07010 8.9385 26.2586 1.55468 0.000523725 AT1G33790 10.481 30.6546 1.54833 0.000523725 AT5G24600 1.41965 4.14103 1.54446 0.000523725 AT5G39580 41.6778 120.839 1.53573 0.000523725 AT1G63057 2.07407 6.00921 1.53471 0.0116163 AT1G65500 2.46155 7.1168 1.53166 0.000523725 AT2G26530 6.07572 17.4999 1.52622 0.000523725 AT5G44565 1.02484 2.94018 1.5205 0.0280023 AT4G31970 1.6995 4.87089 1.51907 0.000523725 AT5G66816 2.46934 7.07603 1.51882 0.00259159 AT3G53200 0.933925 2.67465 1.51797 0.00181778 AT5G25610 8.60271 24.6287 1.51748 0.000523725 AT4G25380 1.30008 3.70646 1.51144 0.0046928 AT5G45090 0.783153 2.2085 1.4957 0.00365889 AT3G46080 4.45714 12.4936 1.48699 0.000523725 AT4G39410 0.651075 1.82118 1.48398 0.0014071 AT3G03280 7.24736 20.2005 1.47886 0.000523725 AT5G42380 0.843918 2.35048 1.47778 0.000986217 AT3G26820 0.646887 1.79342 1.47113 0.000523725 AT2G30660 4.20462 11.6516 1.47048 0.000523725 AT1G05680 6.84523 18.9683 1.47042 0.000523725 AT1G47395 8.58185 23.7762 1.47016 0.000523725 AT1G17235 0.545985 1.51248 1.46999 0.0316227 AT1G77160 1.25522 3.45899 1.46241 0.000523725 AT2G41480 13.4865 37.1061 1.46014 0.000523725 AT1G07280 1.48068 4.07276 1.45975 0.000523725 AT3G44260 8.99207 24.6753 1.45634 0.000523725 AT5G64060 1.90828 5.22989 1.45451 0.000523725 AT5G16080 2.33565 6.3841 1.45066 0.000523725 AT1G64065 0.7229 1.96873 1.44539 0.00400116 AT5G06760 0.966839 2.6293 1.44333 0.00815255 AT2G21640 5.29806 14.4001 1.44254 0.000523725 AT4G19200 156.202 424.264 1.44155 0.000523725 AT1G20080 0.172615 0.467761 1.43821 0.0346729 AT3G10720 58.4607 158.327 1.43737 0.000523725 AT1G50060 47.4036 128.005 1.43313 0.000523725 AT3G19430 30.7229 82.9055 1.43215 0.000523725 AT1G30760 15.5511 41.8888 1.42954 0.000523725 AT4G38210 8.72017 23.4853 1.42933 0.000523725 AT2G47950 5.63214 15.1584 1.42836 0.000523725 AT4G38420 8.07845 21.6928 1.42507 0.000523725 AT1G36622 2.32458 6.23887 1.42431 0.000523725 AT5G24280 1.24691 3.33715 1.42026 0.000523725 AT5G11180 0.330063 0.880565 1.41569 0.0014071 AT5G20230 9.72315 25.9122 1.41414 0.000523725 AT3G55515 1.91218 5.08955 1.41232 0.000523725 AT3G11180 0.402467 1.06552 1.40461 0.00501767 AT4G39830 2.48869 6.58006 1.40272 0.000523725 AT3G12685 0.753276 1.99029 1.40173 0.0333889 AT1G01070 15.482 40.8714 1.4005 0.000523725 AT3G10986 1.71125 4.51428 1.39944 0.000523725 AT1G70510 0.295193 0.774262 1.39116 0.0320622 AT4G02280 8.12612 21.2875 1.38937 0.000523725 AT5G20420 0.37749 0.985075 1.3838 0.000523725 AT3G01840 0.474878 1.2366 1.38075 0.0168598 AT3G02000 2.17372 5.65173 1.37853 0.0270627 AT3G09390 34.7674 90.3231 1.37736 0.000523725 AT1G05280 5.63192 14.6199 1.37623 0.000523725 AT1G47400 6.71258 17.3859 1.37298 0.000523725 AT1G22340 0.302973 0.784526 1.37263 0.0212284 AT5G48130 0.472942 1.22425 1.37217 0.00259159 AT2G06255 1.58863 4.09819 1.3672 0.00295584 AT5G65890 0.305711 0.787177 1.36452 0.0214594 AT5G60520 31.0181 79.822 1.36368 0.000523725 AT2G27389 8.53871 21.9648 1.3631 0.000523725 AT4G23590 1.59734 4.10654 1.36225 0.000523725 AT5G12330 12.4256 31.9193 1.36111 0.000523725 AT2G30140 7.61886 19.5235 1.35757 0.000523725 AT2G43620 14.5106 37.1429 1.35598 0.000523725 AT1G61470 0.674287 1.71788 1.34919 0.00991024 AT1G05540 0.446117 1.1364 1.34897 0.013038 AT2G29340 5.26797 13.3793 1.34469 0.000523725 AT5G17350 8.11262 20.5808 1.34306 0.000523725 AT5G65500 0.548281 1.39013 1.34223 0.000523725 AT5G13080 9.43794 23.8056 1.33476 0.000523725 AT1G55020 96.6291 243.461 1.33316 0.000523725 AT3G12500 131.041 329.623 1.3308 0.000523725 AT5G13910 22.1315 55.6409 1.33004 0.000523725 AT5G42930 0.965075 2.41764 1.32489 0.000523725 AT1G48000 2.44458 6.12282 1.32461 0.000523725 AT3G52780 1.4721 3.68173 1.32251 0.000523725 AT1G06330 2.74308 6.8557 1.32151 0.000523725 AT1G09950 1.24429 3.10046 1.31716 0.000523725 AT5G50160 0.211456 0.526777 1.31684 0.0184226 AT4G29610 1.24358 3.09352 1.31475 0.00222163 AT5G57510 1.82032 4.52423 1.31348 0.00259159 AT5G55490 0.476265 1.18038 1.30941 0.000523725 AT1G67100 0.65421 1.62136 1.30938 0.0277649 AT1G66920 0.276764 0.685821 1.30917 0.0138333 AT4G27460 0.704318 1.73952 1.30439 0.00295584 AT3G47380 9.98894 24.6557 1.30352 0.000523725 AT4G19700 11.5237 28.4214 1.30237 0.000523725 AT4G12545 153.762 378.492 1.29957 0.000523725 AT1G74010 24.5914 60.3836 1.296 0.000523725 AT5G42580 0.980846 2.40758 1.29549 0.000523725 AT1G63750 0.946964 2.32429 1.29541 0.000523725 AT1G07373 5.19346 12.7467 1.29536 0.000523725 AT5G40210 2.52497 6.19535 1.29492 0.000523725 AT3G24540 0.941286 2.30956 1.29491 0.000523725 AT3G50030 0.728971 1.78775 1.29421 0.000986217 AT4G37870 143.45 350.365 1.28831 0.000523725 AT1G62530 0.481577 1.17549 1.28742 0.0351377 AT2G41730 2.9133 7.10229 1.28563 0.000523725 AT4G04810 12.6971 30.9275 1.28439 0.000523725 AT4G00893 0.341421 0.831595 1.28433 0.0492281 AT2G29460 4.32429 10.5299 1.28396 0.000523725 AT2G44840 0.821613 1.99673 1.28111 0.0138333 AT5G03360 0.407184 0.989008 1.2803 0.0014071 AT5G35940 6.02339 14.6136 1.27867 0.000523725 AT2G36120 202.911 492.238 1.27851 0.000523725 AT3G15510 2.32293 5.6333 1.27803 0.000523725 AT5G23010 41.7988 101.336 1.27761 0.000523725 AT1G20180 0.423853 1.02749 1.27749 0.0181532 AT3G06355 2.49576 6.035 1.27388 0.0256422 AT3G14362 5.9793 14.4395 1.27198 0.00400116 AT2G43890 11.1427 26.9004 1.27153 0.000523725 AT3G01600 1.9038 4.59107 1.26995 0.000523725 AT5G19890 38.8148 93.5601 1.26929 0.000523725 AT2G48090 28.5637 68.7448 1.26707 0.000523725 AT1G04490 2.88265 6.93755 1.26703 0.000523725 AT5G46130 0.407942 0.977642 1.26094 0.0404929 AT4G25010 2.99846 7.18271 1.26031 0.000523725 AT4G39580 1.478 3.52744 1.25498 0.000986217 AT2G23620 13.1603 31.3866 1.25396 0.000523725 AT5G53990 6.39163 15.2431 1.2539 0.000523725 AT2G27080 32.6271 77.7656 1.25306 0.000523725 AT5G09720 1.40561 3.33931 1.24835 0.000523725 AT3G05650 0.379617 0.901776 1.24822 0.0014071 AT5G45630 1.69064 4.00616 1.24465 0.00181778 AT2G02250 1.36354 3.22618 1.24247 0.000986217 AT1G09650 0.256037 0.604488 1.23936 0.0333889 AT2G43660 3.19968 7.54142 1.23691 0.0046928 AT1G09070 77.5916 182.554 1.23435 0.000523725 AT2G02850 52.4807 123.424 1.23376 0.000523725 AT5G09980 9.85547 23.1767 1.23368 0.000523725 AT2G02990 4.3219 10.1285 1.22869 0.000523725 AT5G20820 24.877 58.0772 1.22316 0.000523725 AT4G13395 3.07551 7.16424 1.21999 0.000986217 AT5G47920 7.43538 17.2974 1.21807 0.000523725 AT3G47510 20.8486 48.4977 1.21796 0.000523725 AT5G43580 109.685 255.035 1.21733 0.000523725 AT2G40910 0.493898 1.14792 1.21673 0.013038 AT4G09300 0.569254 1.32104 1.21453 0.0253893 AT5G49620 1.65339 3.83303 1.21306 0.000523725 AT4G25470 1.17321 2.71395 1.20993 0.00815255 AT5G60250 0.492061 1.13778 1.20932 0.000986217 AT3G61190 8.63858 19.9033 1.20414 0.000523725 AT5G49520 9.73534 22.3907 1.2016 0.000523725 AT5G53486 2.62611 6.03836 1.20123 0.000523725 AT1G78290 12.2136 28.0551 1.19978 0.0101982 AT1G19380 21.1351 48.5009 1.19837 0.000523725 AT4G00050 0.982755 2.25267 1.19673 0.00903988 AT5G43980 1.08102 2.47315 1.19396 0.00365889 AT2G21510 2.18758 4.9991 1.19233 0.000523725 AT5G24040 1.84508 4.20346 1.18789 0.000523725 AT1G12200 29.6012 67.209 1.183 0.000523725 AT3G05190 2.93551 6.66474 1.18294 0.000523725 AT5G39050 3.17075 7.19004 1.18118 0.000523725 AT4G34710 74.0895 167.826 1.17963 0.000523725 AT1G69526 4.42727 10.0194 1.1783 0.000523725 AT2G26690 8.49728 19.19 1.17528 0.000523725 AT1G78780 15.487 34.9678 1.17497 0.0014071 AT2G17280 29.4859 66.5117 1.17358 0.000523725 AT5G10990 5.17652 11.6519 1.17052 0.000523725 AT5G57320 0.572536 1.28834 1.17008 0.000523725 AT4G15260 3.84437 8.64617 1.16931 0.000523725 AT5G25440 10.3969 23.3064 1.16458 0.000523725 AT4G01250 2.63276 5.89529 1.16299 0.000523725 AT2G38823 1.45117 3.24731 1.16203 0.00295584 AT2G23120 499.68 1117.7 1.16146 0.000523725 AT4G27652 28.3882 63.4677 1.16073 0.000523725 AT1G28370 4.36405 9.74782 1.15941 0.000523725 AT1G62440 7.23256 16.1491 1.15888 0.000523725 AT5G22800 3.3557 7.48488 1.15736 0.000523725 AT3G06490 0.644939 1.43758 1.1564 0.0069337 AT1G61340 5.43434 12.1054 1.15547 0.000523725 AT2G29670 2.52045 5.60135 1.15209 0.000523725 AT5G16360 18.3651 40.7821 1.15097 0.000523725 AT1G09310 3.14571 6.98119 1.15009 0.0186634 AT3G26590 29.7585 66.0401 1.15004 0.000523725 AT4G28410 7.75611 17.2066 1.14955 0.000523725 AT2G43600 3.79757 8.42131 1.14897 0.000523725 AT5G40590 93.0884 206.302 1.14809 0.000523725 AT1G13590 33.4414 73.9898 1.14569 0.000523725 AT4G19460 2.48214 5.4765 1.14167 0.000523725 AT5G46720 2.16801 4.78282 1.14149 0.00566733 AT4G11350 2.82913 6.2381 1.14075 0.000523725 AT2G28400 6.66919 14.7007 1.1403 0.000523725 AT1G12845 4.66428 10.2794 1.14003 0.000523725 AT4G06065 6.12754 13.4996 1.13954 0.0486949 AT5G17850 3.83242 8.43762 1.13858 0.000523725 AT2G37760 27.2222 59.9308 1.13851 0.000523725 AT4G14548 1.86009 4.07685 1.13208 0.0107652 AT1G06180 12.5792 27.5192 1.1294 0.000523725 AT5G38700 8.39044 18.3515 1.12908 0.000523725 AT1G19200 2.12912 4.6489 1.12663 0.00661062 AT3G04420 10.2932 22.4731 1.12651 0.000523725 AT1G51870 0.670704 1.46182 1.12402 0.0014071 AT5G53750 2.97673 6.47424 1.12098 0.000523725 AT1G50090 3.7808 8.20263 1.11739 0.000523725 AT1G64900 3.09788 6.71381 1.11585 0.000523725 AT5G43380 5.64185 12.217 1.11465 0.000523725 AT5G59590 0.865101 1.87328 1.11463 0.00566733 AT5G65870 4.57686 9.90965 1.11448 0.000523725 AT2G15490 30.8321 66.6962 1.11317 0.000523725 AT5G55350 0.660041 1.42695 1.11231 0.0362073 AT5G48000 17.6134 37.9913 1.109 0.000523725 AT1G66500 6.78612 14.562 1.10155 0.000523725 AT4G33970 0.206392 0.442665 1.10083 0.0398638 AT4G12480 445.737 955.104 1.09947 0.000523725 AT1G70260 14.7513 31.541 1.09639 0.000523725 AT4G02170 1.57992 3.37393 1.09458 0.0231794 AT5G03860 3.35068 7.14908 1.0933 0.000523725 AT4G37180 12.9443 27.6094 1.09285 0.000523725 AT3G53540 10.4153 22.1927 1.09138 0.000523725 AT1G08430 1.43923 3.06402 1.09013 0.000523725 AT2G25735 1.50789 3.21017 1.09012 0.00259159 AT1G72450 9.39025 19.9838 1.08959 0.000523725 AT3G05470 0.977489 2.07913 1.08883 0.000523725 AT5G13750 29.8535 63.4751 1.08829 0.000523725 AT1G73965 1.37034 2.91133 1.08715 0.0275493 AT2G02010 5.46317 11.5873 1.08473 0.000523725 AT1G22490 1.56851 3.32632 1.08453 0.000523725 AT1G67850 3.35973 7.12476 1.0845 0.000523725 AT1G65570 10.2527 21.718 1.08288 0.000523725 AT5G16410 0.697461 1.47705 1.08254 0.0113279 AT1G02220 28.5095 60.3709 1.08241 0.000523725 AT2G32660 5.04364 10.6725 1.08137 0.000523725 AT3G54510 0.636419 1.34315 1.07757 0.0046928 AT2G40610 4.39621 9.27465 1.07703 0.000523725 AT4G15360 1.68334 3.55045 1.07668 0.000523725 AT3G15370 12.4288 26.2063 1.07622 0.000523725 AT1G47960 9.47012 19.9521 1.07508 0.000523725 AT5G12890 4.34158 9.13967 1.07392 0.000523725 AT3G12520 4.51927 9.51037 1.07341 0.000523725 AT4G33120 4.18338 8.79934 1.07272 0.000523725 AT3G30842 0.518182 1.08617 1.06772 0.000523725 AT2G28630 0.810232 1.69779 1.06725 0.00330941 AT4G16563 9.59224 20.0726 1.06529 0.000523725 AT4G27654 5.48144 11.4534 1.06314 0.0116163 AT1G73620 59.3115 123.843 1.06213 0.000523725 AT5G54400 2.10164 4.38111 1.05978 0.0014071 AT2G41800 75.4918 157.346 1.05955 0.000523725 AT4G34320 4.49576 9.36967 1.05943 0.000523725 AT2G04190 4.59275 9.56627 1.0586 0.000523725 AT1G53470 11.1463 23.2076 1.05803 0.000523725 AT4G35070 1.10451 2.29694 1.0563 0.00222163 AT3G55700 3.06218 6.36664 1.05597 0.000523725 AT2G04100 8.89045 18.4842 1.05596 0.000523725 AT1G54890 30.7279 63.8651 1.05548 0.000523725 AT1G77405 0.65839 1.36839 1.05546 0.0284439 AT1G69480 1.03701 2.15199 1.05324 0.000523725 AT5G62520 12.642 26.2125 1.05204 0.019196 AT2G15090 1.72341 3.57305 1.05189 0.000523725 AT2G26700 1.67386 3.4679 1.05089 0.000523725 AT4G12290 0.274874 0.569258 1.05031 0.0251498 AT2G35730 7.15442 14.8156 1.05021 0.000523725 AT2G30220 1.04471 2.16328 1.05012 0.0113279 AT5G59030 3.75364 7.76619 1.04892 0.000523725 AT1G17250 1.4122 2.92068 1.04836 0.0113279 AT1G14687 1.0233 2.11615 1.04821 0.0434207 AT3G52748 48.1661 99.3696 1.04479 0.000523725 AT1G18300 9.55317 19.6576 1.04103 0.000523725 AT1G20190 28.3933 58.4077 1.04061 0.000523725 AT2G36650 4.40395 9.05051 1.0392 0.000523725 AT1G69430 0.598281 1.22807 1.0375 0.0222131 AT2G29120 0.391839 0.80417 1.03724 0.0069337 AT4G27250 1.44939 2.97208 1.03602 0.00259159 AT4G16008 1.73591 3.5595 1.03598 0.000523725 AT2G15760 3.22807 6.59245 1.03014 0.000523725 AT5G12340 10.6838 21.7776 1.02741 0.000523725 AT1G21910 11.7473 23.9217 1.02599 0.000523725 AT4G30090 1.37588 2.79854 1.02432 0.000986217 AT1G73880 7.37038 14.977 1.02294 0.000523725 AT3G54530 0.759914 1.54213 1.02102 0.0368736 AT5G06730 15.6483 31.7376 1.02019 0.000523725 AT1G08100 5.49234 11.1259 1.01843 0.000523725 AT5G14650 166.711 336.953 1.0152 0.000523725 AT1G76930 488.458 986.493 1.01408 0.000523725 AT1G60989 72.0489 145.494 1.01391 0.000523725 AT5G23020 168.732 340.365 1.01235 0.000523725 AT4G26700 3.41796 6.89409 1.01222 0.000523725 AT2G34340 2.76851 5.58324 1.01199 0.000523725 AT5G43620 4.07492 8.21073 1.01074 0.000523725 AT1G15385 7.71967 15.5316 1.0086 0.000523725 AT4G18170 1.29433 2.60182 1.00732 0.0046928 AT1G10530 5.18518 10.422 1.00717 0.000523725 AT5G14730 11.1199 22.3326 1.00601 0.000523725 AT1G79310 3.30712 6.64144 1.00592 0.000523725 AT5G43590 0.834483 1.67168 1.00234 0.013579 AT3G16330 14.9946 29.9956 1.00031 0.000523725 AT2G26870 2.0018 4.00419 1.00022 0.000523725 AT1G61667 34.1294 17.0633 -1.00012 0.000523725 AT5G44410 4.02734 2.01324 -1.00031 0.000523725 AT3G44770 2.38762 1.19239 -1.00172 0.00566733 AT1G10800 2.93458 1.46471 -1.00254 0.0366645 AT1G31320 31.8374 15.8764 -1.00384 0.000523725 AT1G53230 7.91206 3.94516 -1.00397 0.000523725 AT3G44540 23.1148 11.5197 -1.00471 0.000523725 AT3G49845 41.5192 20.6871 -1.00505 0.000523725 AT2G20100 3.97763 1.98078 -1.00584 0.000523725 AT1G53680 35.2181 17.5368 -1.00593 0.000523725 AT5G13900 45.7207 22.7523 -1.00684 0.0014071 AT3G20200 1.41804 0.7056 -1.00698 0.000523725 AT3G21890 3.30835 1.64574 -1.00738 0.0069337 AT5G11440 10.5177 5.22908 -1.00819 0.000523725 AT2G28250 53.6946 26.6945 -1.00824 0.000523725 AT1G73860 4.24894 2.1119 -1.00856 0.000523725 AT2G17850 8.12268 4.03578 -1.00911 0.0186634 AT3G12580 36.5075 18.1326 -1.00961 0.000523725 AT1G72180 9.22595 4.5808 -1.0101 0.000523725 AT3G56240 348.878 173.16 -1.01062 0.000523725 AT3G18660 3.90535 1.93662 -1.01191 0.000523725 AT5G41040 133.814 66.3317 -1.01246 0.000523725 AT3G20450 12.1733 6.03413 -1.01251 0.00181778 AT1G60750 3.07574 1.52454 -1.01256 0.0105003 AT1G25450 6.18811 3.06607 -1.01311 0.000523725 AT2G48130 47.8941 23.7213 -1.01366 0.000523725 AT1G74770 26.0244 12.8863 -1.01403 0.000523725 AT2G04680 5.97907 2.95909 -1.01476 0.000523725 AT5G16530 7.64261 3.78228 -1.01481 0.000523725 AT4G18510 13.8491 6.8489 -1.01585 0.000523725 AT1G35240 1.45246 0.718133 -1.01618 0.0116163 AT5G13580 30.7503 15.2038 -1.01618 0.000523725 AT5G38030 27.4276 13.5451 -1.01785 0.000523725 AT2G31250 2.28577 1.12839 -1.01841 0.0046928 AT1G67830 4.44543 2.19144 -1.02044 0.00844927 AT1G78260 18.562 9.1466 -1.02105 0.000523725 AT3G55330 1.66474 0.820304 -1.02107 0.0430689 AT3G19030 525.735 258.756 -1.02275 0.000523725 AT1G22550 13.4544 6.62098 -1.02296 0.000523725 AT2G25900 25.8139 12.7025 -1.02303 0.000523725 AT5G18350 0.611372 0.300329 -1.0255 0.0138333 AT1G53060 2.54292 1.24739 -1.02757 0.0176477 AT5G11160 3.68347 1.80668 -1.02772 0.0014071 AT5G65340 2.98859 1.46566 -1.02792 0.00598846 AT4G08290 7.08388 3.4739 -1.02798 0.000523725 AT1G57560 14.7801 7.24732 -1.02814 0.000523725 AT4G35030 30.5015 14.9466 -1.02906 0.000523725 AT2G24270 2.7133 1.32884 -1.02988 0.00259159 AT3G06460 29.5767 14.4842 -1.02998 0.000523725 AT1G34670 32.3385 15.8312 -1.03049 0.000523725 AT4G15960 10.4639 5.11987 -1.03125 0.000523725 AT5G48740 1.36972 0.670113 -1.0314 0.0197013 AT3G58810 12.7756 6.24854 -1.0318 0.000523725 AT5G01360 8.20917 4.00825 -1.03427 0.000523725 AT3G20820 5.91174 2.88223 -1.03639 0.000523725 AT5G39000 1.65357 0.805728 -1.03722 0.000523725 AT1G54940 5.28365 2.57167 -1.03883 0.000523725 AT1G33090 2.55995 1.24341 -1.04181 0.00181778 AT2G23550 1.74642 0.847071 -1.04385 0.019196 AT3G44730 12.1645 5.89003 -1.04633 0.000523725 AT4G03010 2.92556 1.41433 -1.04859 0.000523725 AT2G02450 2.35839 1.13936 -1.04958 0.00330941 AT5G63580 4.37404 2.11147 -1.05072 0.000523725 AT2G48140 124.993 60.3205 -1.05112 0.000523725 AT1G05370 3.98979 1.9246 -1.05175 0.000523725 AT4G34830 2.80349 1.3522 -1.05192 0.000523725 AT4G19680 11.0856 5.34245 -1.05311 0.000523725 AT1G05320 22.5194 10.8439 -1.05429 0.000523725 AT2G47360 22.9858 11.0668 -1.0545 0.000523725 AT1G78815 11.1498 5.36774 -1.05464 0.000523725 AT5G26790 4.36033 2.09777 -1.05558 0.00903988 AT4G27290 2.20613 1.06105 -1.05602 0.00181778 AT1G64500 4.83116 2.32336 -1.05616 0.000523725 AT5G28960 2.17233 1.04449 -1.05644 0.00259159 AT4G01120 29.1357 14.0043 -1.05692 0.000523725 AT5G52790 4.61057 2.21574 -1.05716 0.000523725 AT3G20557 2.03231 0.976649 -1.05721 0.0450427 AT2G23530 5.85062 2.81145 -1.05727 0.000523725 AT5G58860 188.915 90.7355 -1.058 0.000523725 AT1G46768 6.57744 3.15913 -1.058 0.000523725 AT1G78530 2.57581 1.23687 -1.05833 0.00365889 AT5G25240 7.31355 3.51088 -1.05874 0.00534991 AT2G43050 8.51167 4.08557 -1.0589 0.000523725 AT3G16650 1.86033 0.89267 -1.05936 0.00365889 AT5G53500 10.1848 4.88556 -1.05982 0.000523725 AT2G22240 15.9102 7.62797 -1.06058 0.00631038 AT3G44990 715.84 343.115 -1.06095 0.000523725 AT4G19530 0.601242 0.287968 -1.06204 0.00991024 AT5G02270 242.203 115.964 -1.06254 0.000523725 AT4G26120 2.96183 1.41765 -1.06298 0.000523725 AT1G16420 3.24458 1.55277 -1.06318 0.000986217 AT1G68850 50.3608 24.1007 -1.06322 0.000523725 AT3G61310 3.2543 1.55721 -1.06338 0.000523725 AT2G18120 2.50767 1.19833 -1.06532 0.00934061 AT3G06125 70.6383 33.7256 -1.06661 0.000523725 AT1G22160 2.43533 1.16122 -1.06848 0.0454711 AT5G04000 2.46351 1.17456 -1.06859 0.04668 AT1G29910 2.92154 1.39231 -1.06925 0.00435758 AT3G12110 41.2111 19.6336 -1.06971 0.000523725 AT2G44690 6.89803 3.28324 -1.07106 0.000523725 AT1G14630 23.3253 11.1002 -1.07131 0.000523725 AT2G05310 3.30246 1.57138 -1.07151 0.018947 AT2G27740 8.12906 3.86226 -1.07364 0.000986217 AT5G22870 7.64186 3.63009 -1.07392 0.000986217 AT1G21810 2.73857 1.29974 -1.0752 0.000986217 AT3G47710 9.86727 4.67989 -1.07618 0.000523725 AT4G17785 2.13577 1.01284 -1.07636 0.00786527 AT3G55990 16.7569 7.94357 -1.0769 0.000523725 AT5G10965 4.64073 2.19877 -1.07765 0.000523725 AT2G44110 12.4383 5.89285 -1.07775 0.000523725 AT1G35250 12.6878 6.00644 -1.07886 0.000523725 AT1G73600 288.334 136.222 -1.08178 0.000523725 AT2G20750 34.5244 16.307 -1.08213 0.000523725 AT1G48480 33.8277 15.9684 -1.08299 0.000523725 AT4G17220 11.2358 5.30253 -1.08336 0.0014071 AT5G19970 10.9943 5.18846 -1.08338 0.000523725 AT1G70210 7.20674 3.40095 -1.08341 0.000523725 AT1G26410 1.38586 0.653291 -1.08498 0.0101982 AT3G05890 148.76 70.1017 -1.08546 0.000523725 AT3G10470 2.66357 1.25505 -1.08562 0.000523725 AT1G19540 6.72348 3.16352 -1.08767 0.00181778 AT2G15830 31.7137 14.9216 -1.08771 0.000523725 AT5G28770 32.6212 15.3467 -1.08788 0.000523725 AT2G27920 14.9519 7.02805 -1.08913 0.0474771 AT5G65207 196.402 92.3159 -1.08916 0.000523725 AT3G43190 65.1808 30.5846 -1.09164 0.000523725 AT5G38820 2.27541 1.06725 -1.09222 0.00365889 AT1G70860 9.32601 4.37344 -1.09249 0.000523725 AT3G45390 2.41493 1.13208 -1.09301 0.000523725 AT1G64200 52.5796 24.6473 -1.09307 0.000523725 AT4G28500 4.25966 1.99562 -1.0939 0.000523725 AT4G36740 5.1498 2.40934 -1.09588 0.00259159 AT3G60840 16.0787 7.51806 -1.09672 0.000523725 AT5G16240 6.70834 3.13339 -1.09823 0.000523725 AT5G61340 72.8699 34.0232 -1.0988 0.000523725 AT3G54830 1.49904 0.699893 -1.09884 0.0069337 AT3G09240 8.79445 4.10496 -1.09923 0.000523725 AT5G22920 30.7412 14.3308 -1.10105 0.000523725 AT3G55090 2.95723 1.37846 -1.10119 0.000523725 AT1G67148 31.6838 14.7644 -1.10163 0.000523725 AT2G25410 3.32778 1.55072 -1.10163 0.00330941 AT3G27400 14.9037 6.94143 -1.10237 0.000523725 AT1G26200 2.84721 1.32441 -1.1042 0.00222163 AT5G49800 9.72712 4.51782 -1.10639 0.000523725 AT5G23400 16.0554 7.44918 -1.1079 0.000523725 AT4G23980 17.9086 8.29328 -1.11064 0.000523725 AT3G57780 6.3141 2.92146 -1.11188 0.000523725 AT5G62340 52.7407 24.3982 -1.11214 0.000523725 AT4G21745 2.31961 1.07261 -1.11276 0.0143698 AT5G59360 2.73213 1.26199 -1.11433 0.00844927 AT1G27380 6.93775 3.20456 -1.11434 0.00501767 AT1G13670 32.6356 15.0724 -1.11454 0.000523725 AT1G33170 29.188 13.4764 -1.11494 0.000523725 AT1G51440 1.7393 0.802964 -1.1151 0.00181778 AT5G37410 0.930936 0.42923 -1.11693 0.0165975 AT3G54890 15.7863 7.27343 -1.11796 0.000523725 AT3G02140 24.2332 11.1558 -1.11919 0.000523725 AT1G62700 1.29436 0.595575 -1.11988 0.0229574 AT3G01670 24.7187 11.364 -1.12113 0.000523725 AT2G46790 2.32186 1.06708 -1.12162 0.0014071 AT2G16760 22.1824 10.1795 -1.12375 0.000523725 AT5G19260 8.63891 3.96383 -1.12395 0.000523725 AT2G23610 37.4605 17.1668 -1.12575 0.000523725 AT4G16640 1.99264 0.913129 -1.12579 0.00259159 AT5G03885 1.63296 0.748255 -1.12589 0.0312051 AT2G45890 12.7714 5.84368 -1.12797 0.000523725 AT1G27480 0.828842 0.379185 -1.12819 0.0460496 AT2G40750 15.9622 7.29672 -1.12934 0.000523725 AT2G15960 2.9213 1.33528 -1.12947 0.0231794 AT5G44390 5.0593 2.31162 -1.13003 0.000523725 AT4G20050 3.68329 1.68283 -1.1301 0.000523725 AT1G30515 9.04832 4.13283 -1.13052 0.000523725 AT3G47950 7.20982 3.29194 -1.13103 0.00295584 AT4G29905 193.647 88.3895 -1.13148 0.000523725 AT3G25930 106.459 48.5825 -1.13179 0.000523725 AT5G57785 60.4317 27.5725 -1.13208 0.0014071 AT3G61750 7.82055 3.56746 -1.13237 0.000523725 AT2G47810 4.55839 2.0786 -1.13292 0.00259159 AT4G32950 12.049 5.49196 -1.13352 0.000523725 AT1G55290 4.43789 2.02142 -1.13451 0.000523725 AT1G26570 1.64374 0.748567 -1.13478 0.00365889 AT3G11430 30.4816 13.8803 -1.1349 0.000523725 AT5G23000 5.85843 2.66569 -1.13601 0.000523725 AT3G44716 3.54482 1.61293 -1.13602 0.00754938 AT5G17780 3.75371 1.70623 -1.13751 0.000523725 AT3G13600 13.0316 5.92227 -1.1378 0.000523725 AT2G43910 271.802 123.452 -1.13861 0.000523725 AT4G14280 1.44259 0.654949 -1.1392 0.0014071 AT2G45560 3.50973 1.59177 -1.14072 0.000986217 AT5G20270 15.2562 6.91373 -1.14186 0.000523725 AT5G43470 1.65562 0.750176 -1.14207 0.000523725 AT5G19410 15.9993 7.24511 -1.14293 0.000523725 AT4G35100 488.991 221.407 -1.14311 0.000523725 AT5G39670 20.551 9.30081 -1.14378 0.000523725 AT3G13100 8.18769 3.70551 -1.14379 0.00631038 AT5G21130 1.62411 0.734405 -1.145 0.0387264 AT1G75030 5.70091 2.57704 -1.14548 0.000523725 AT4G24140 63.8203 28.8304 -1.14642 0.000523725 AT3G06370 9.38462 4.23525 -1.14785 0.000523725 AT5G03960 9.91813 4.4748 -1.14825 0.000523725 AT1G80730 4.27538 1.92749 -1.14933 0.00222163 AT1G67150 4.25077 1.91622 -1.14946 0.000523725 AT4G26790 10.0783 4.54055 -1.15031 0.000523725 AT5G23030 4.48717 2.02084 -1.15085 0.000523725 AT5G12420 77.2633 34.7705 -1.15192 0.000523725 AT5G36870 1.3818 0.621276 -1.15325 0.000523725 AT2G23400 2.20776 0.991703 -1.1546 0.00963516 AT5G54510 13.6908 6.14949 -1.15467 0.000523725 AT1G61810 2.6037 1.16899 -1.1553 0.0014071 AT4G17480 2.75752 1.23775 -1.15565 0.0014071 AT5G42785 18.3999 8.24279 -1.15849 0.000523725 AT1G19715 13.1976 5.9071 -1.15976 0.0014071 AT2G19060 12.089 5.41 -1.15999 0.000523725 AT1G64625 1.30908 0.584989 -1.16207 0.00501767 AT1G51405 2.1504 0.960611 -1.16258 0.000523725 AT5G09440 45.6043 20.3557 -1.16373 0.000523725 AT3G05860 2.0901 0.932541 -1.16433 0.031381 AT1G61950 2.70636 1.20745 -1.16439 0.000523725 AT1G20990 2.13447 0.951411 -1.16574 0.00365889 AT4G38690 2.42977 1.08101 -1.16844 0.000986217 AT5G28610 10.023 4.45893 -1.16855 0.000523725 AT4G37610 45.6069 20.2825 -1.16901 0.000523725 AT3G57950 5.30454 2.35309 -1.17267 0.000986217 AT3G16400 317.2 140.685 -1.17293 0.000523725 AT2G04430 28.4634 12.6092 -1.17463 0.000523725 AT2G43390 12.1893 5.39962 -1.17469 0.000523725 AT5G01740 28.0791 12.4354 -1.17505 0.000523725 AT2G23690 5.46337 2.41928 -1.17521 0.000523725 AT4G40010 10.1211 4.47991 -1.17582 0.000523725 AT3G49750 13.8133 6.10686 -1.17756 0.000523725 AT1G53163 2.35254 1.03995 -1.17771 0.00566733 AT2G30820 4.64209 2.04838 -1.18029 0.000523725 AT5G35525 6.30071 2.78028 -1.18029 0.00222163 AT1G28170 4.48608 1.97411 -1.18425 0.000523725 AT1G78320 18.1028 7.96522 -1.18443 0.000523725 AT1G47603 1.77197 0.779211 -1.18527 0.00903988 AT1G49430 36.2852 15.9294 -1.18769 0.000523725 AT4G34060 1.20624 0.529125 -1.18883 0.000523725 AT5G18661 21.4898 9.42456 -1.18916 0.000523725 AT3G22060 9.97955 4.37596 -1.18938 0.000523725 AT1G74830 3.22167 1.41149 -1.19059 0.000523725 AT4G38400 6.95855 3.04666 -1.19156 0.000523725 AT2G20340 4.15498 1.81866 -1.19196 0.000523725 AT5G07130 16.3434 7.14963 -1.19277 0.000523725 AT5G42250 51.6926 22.6075 -1.19316 0.000523725 AT5G11590 2.81675 1.23167 -1.19341 0.000523725 AT3G07490 7.96012 3.47816 -1.19447 0.000986217 AT4G11190 29.1097 12.7122 -1.19528 0.000523725 AT5G07660 1.24141 0.542076 -1.19541 0.000523725 AT5G14760 7.85877 3.43068 -1.19581 0.000523725 AT5G14340 7.34584 3.20564 -1.19632 0.000523725 AT1G11740 1.62625 0.707605 -1.20053 0.00181778 AT3G61210 5.71396 2.48588 -1.20074 0.000523725 AT4G38080 387.791 168.707 -1.20076 0.000523725 AT3G15450 268.821 116.877 -1.20166 0.000523725 AT5G57670 1.23167 0.535063 -1.20284 0.00534991 AT5G25810 82.6748 35.9082 -1.20314 0.000523725 AT3G07600 18.8836 8.19952 -1.20353 0.0143698 AT5G38010 12.7465 5.53321 -1.20391 0.000523725 AT1G42550 4.62944 2.00825 -1.2049 0.00815255 AT1G22030 9.60193 4.15715 -1.20773 0.000523725 AT5G52670 5.98535 2.5886 -1.20926 0.00295584 AT1G30840 50.9952 22.024 -1.21128 0.000523725 AT5G62420 11.9129 5.13841 -1.21313 0.000523725 AT3G45330 2.86214 1.22954 -1.21897 0.000523725 AT3G18900 11.5967 4.97908 -1.21976 0.000523725 AT1G70450 1.23708 0.531064 -1.21999 0.02072 AT5G44680 1.0902 0.466378 -1.22503 0.0141026 AT2G21330 2.90377 1.24125 -1.22613 0.000523725 AT4G17760 5.3457 2.2836 -1.22707 0.000523725 AT1G08500 23.631 10.0726 -1.23025 0.000523725 AT4G18010 59.8008 25.4809 -1.23075 0.000523725 AT2G38320 16.8911 7.18612 -1.23297 0.000523725 AT2G47200 56.0968 23.8546 -1.23365 0.000523725 AT2G46570 2.65477 1.12881 -1.23379 0.0141026 AT1G79860 2.96531 1.26071 -1.23395 0.000523725 AT2G24030 1.29352 0.549068 -1.23624 0.00991024 AT4G15740 7.29212 3.08917 -1.23912 0.000523725 AT3G48970 9.309 3.93369 -1.24274 0.000523725 AT1G07880 13.7772 5.81859 -1.24354 0.000523725 AT3G08490 2.19163 0.925448 -1.24378 0.00400116 AT1G17190 61.9887 26.172 -1.24398 0.000523725 AT5G41590 9.99799 4.21685 -1.24547 0.000523725 AT1G78430 6.80192 2.86691 -1.24645 0.000523725 AT1G75750 561.699 236.022 -1.25088 0.000523725 AT2G01900 21.3045 8.94215 -1.25246 0.000523725 AT5G54470 3.44665 1.44535 -1.25378 0.000523725 AT2G32510 10.2957 4.31662 -1.25407 0.000523725 AT3G50770 4.34759 1.82193 -1.25474 0.00259159 AT5G44260 2.46174 1.03145 -1.25501 0.000523725 AT3G57020 162.37 68.0283 -1.25508 0.000523725 AT3G51340 2.93221 1.22832 -1.2553 0.000523725 AT4G24180 4.30271 1.80127 -1.25623 0.000523725 AT2G23410 17.1605 7.18163 -1.25671 0.000523725 AT3G22600 208.589 87.2401 -1.2576 0.000523725 AT4G32800 2.29482 0.958919 -1.2589 0.00181778 AT3G22620 433.574 180.922 -1.26091 0.000523725 AT5G56550 5.71358 2.37918 -1.26393 0.000523725 AT3G11390 0.773361 0.322024 -1.26397 0.0121826 AT5G52260 3.2668 1.35801 -1.26639 0.00295584 AT2G18480 2.44496 1.0151 -1.26819 0.000523725 AT1G13610 4.19587 1.73368 -1.27513 0.000523725 AT4G13230 2.398 0.990561 -1.27552 0.0340518 AT2G16980 14.0948 5.8187 -1.2764 0.000523725 AT5G56540 503.715 207.719 -1.27798 0.000523725 AT2G13360 6.07792 2.50516 -1.27868 0.000523725 AT2G36570 48.5102 19.9937 -1.27874 0.000523725 AT4G13680 1.78279 0.734689 -1.27893 0.00400116 AT1G05310 6.56043 2.70186 -1.27983 0.000523725 AT1G77110 0.892765 0.367638 -1.27999 0.00934061 AT5G38000 3.02981 1.24703 -1.28073 0.000523725 AT5G66640 1.39227 0.572453 -1.28221 0.00295584 AT2G30010 9.7509 4.00615 -1.28332 0.000523725 AT1G58590 8.52184 3.49131 -1.2874 0.0266026 AT5G07650 1.78516 0.729386 -1.2913 0.000523725 AT3G20420 0.910045 0.371724 -1.2917 0.0309867 AT5G46115 5.56783 2.27371 -1.29207 0.00754938 AT5G52250 6.65699 2.71737 -1.29266 0.000523725 AT2G44940 21.6625 8.83885 -1.29327 0.000523725 AT3G57500 4.80705 1.95714 -1.29641 0.00330941 AT1G68810 13.5178 5.49999 -1.29736 0.000523725 AT1G76800 12.2324 4.96827 -1.29989 0.000523725 AT4G04750 9.44493 3.83098 -1.30183 0.000523725 AT1G28670 6.92903 2.80554 -1.30438 0.000523725 AT4G35900 4.22187 1.70818 -1.30542 0.000523725 AT1G30280 3.39875 1.37485 -1.30573 0.000523725 AT1G18330 9.42475 3.80802 -1.30742 0.000523725 AT3G55940 3.63781 1.46877 -1.30847 0.000523725 AT1G26380 9.90986 3.99975 -1.30895 0.000523725 AT5G45970 5.85024 2.36014 -1.30963 0.000523725 AT3G20860 18.467 7.44333 -1.31093 0.000523725 AT4G35160 26.6549 10.7367 -1.31185 0.000523725 AT1G68200 2.38637 0.960857 -1.31243 0.000986217 AT4G28350 1.08226 0.435678 -1.31271 0.00534991 AT1G14260 3.7805 1.52108 -1.31348 0.000523725 AT1G78950 7.11124 2.8574 -1.3154 0.000523725 AT1G03620 3.35045 1.34623 -1.31543 0.000523725 AT1G44030 0.933225 0.374944 -1.31555 0.00181778 AT1G03010 2.20208 0.884318 -1.31623 0.000523725 AT5G14330 314.128 125.889 -1.3192 0.000523725 AT2G23540 126.92 50.8615 -1.31927 0.000523725 AT1G01453 3.86673 1.54847 -1.32027 0.000523725 AT2G33460 2.93747 1.17524 -1.32161 0.0444679 AT4G36610 47.3984 18.951 -1.32256 0.000523725 AT1G23160 0.83078 0.332034 -1.32314 0.013038 AT1G72230 50.0986 20.0143 -1.32374 0.000523725 AT5G52720 5.04757 2.01616 -1.32398 0.0113279 AT3G01295 17.8351 7.12317 -1.32413 0.0253893 AT1G73805 2.71384 1.08348 -1.32467 0.0163386 AT4G35180 0.943854 0.376075 -1.32754 0.0046928 AT1G15460 17.4403 6.94873 -1.3276 0.000523725 AT3G15540 8.09566 3.22039 -1.32991 0.000523725 AT2G05070 3.19539 1.26929 -1.33197 0.000523725 AT2G32740 0.803403 0.319059 -1.3323 0.0368736 AT5G07475 89.8167 35.6472 -1.33319 0.000523725 AT2G41240 4.35298 1.72454 -1.33579 0.000523725 AT4G29270 55.5395 21.951 -1.33923 0.000523725 AT5G23190 26.2885 10.3833 -1.34016 0.000523725 AT1G79250 2.13669 0.843385 -1.34112 0.000523725 AT3G11385 0.99223 0.391625 -1.3412 0.00400116 AT1G15540 1.4893 0.587687 -1.34151 0.0214594 AT5G57180 1.49358 0.589006 -1.34242 0.000986217 AT3G05800 8.1736 3.2229 -1.34261 0.000523725 AT5G18910 0.557716 0.219077 -1.3481 0.0342596 AT4G33610 93.4181 36.6693 -1.34913 0.000523725 AT5G58770 8.28905 3.25313 -1.34938 0.000986217 AT3G46370 0.697728 0.273772 -1.34969 0.00435758 AT5G60490 9.82286 3.85135 -1.35078 0.000523725 AT3G05936 3.43631 1.3456 -1.35261 0.00786527 AT5G23370 3.18664 1.24547 -1.35535 0.0014071 AT2G28470 35.585 13.8884 -1.35739 0.000523725 AT4G09130 1.11723 0.435986 -1.35758 0.0357575 AT5G08250 7.12926 2.77905 -1.35916 0.000523725 AT1G01620 406.996 158.603 -1.35959 0.000523725 AT3G49760 23.5621 9.16927 -1.36159 0.000523725 AT2G35340 2.43726 0.947969 -1.36235 0.000523725 AT1G16440 6.61189 2.56654 -1.36524 0.000523725 AT3G42725 9.21804 3.57634 -1.36598 0.000523725 AT5G62280 19.0194 7.37014 -1.36771 0.000523725 AT1G65310 74.0821 28.6959 -1.36828 0.000523725 AT2G17590 1.79992 0.696711 -1.3693 0.000523725 AT1G14280 1.3828 0.534379 -1.37165 0.0046928 AT1G73120 37.1318 14.3315 -1.37346 0.000523725 AT5G18670 41.9142 16.167 -1.37439 0.000523725 AT5G59520 39.4443 15.2078 -1.375 0.000523725 AT5G62360 6.31839 2.43558 -1.37529 0.000523725 AT1G73280 9.3591 3.60586 -1.37603 0.000523725 AT3G10340 20.7814 7.98723 -1.37952 0.000523725 AT3G07070 12.9138 4.96183 -1.37997 0.000523725 AT3G29630 9.32185 3.58156 -1.38003 0.000523725 AT3G50350 77.5853 29.7596 -1.38243 0.000523725 AT2G41370 10.1596 3.89225 -1.38416 0.000523725 AT3G57130 0.625714 0.238562 -1.39114 0.039412 AT5G11570 1.41179 0.538126 -1.39151 0.00365889 AT3G50150 2.33178 0.888516 -1.39196 0.000523725 AT1G23760 4.07254 1.55154 -1.39223 0.000523725 AT2G36830 1083.73 412.67 -1.39295 0.000523725 AT5G21482 6.07435 2.31133 -1.39401 0.000523725 AT1G55330 731.259 277.87 -1.39597 0.000523725 AT2G42380 2.45221 0.930165 -1.39852 0.000523725 AT4G16860 0.44867 0.17015 -1.39885 0.0107652 AT1G17345 0.864502 0.327686 -1.39956 0.0490743 AT1G64590 31.044 11.7652 -1.39978 0.000523725 AT1G73290 1.33722 0.505572 -1.40325 0.00534991 AT5G48400 0.619626 0.234175 -1.40381 0.00661062 AT5G21120 0.610556 0.230745 -1.40383 0.0277649 AT2G36295 8.50877 3.20346 -1.40932 0.000523725 AT4G19690 100.06 37.6265 -1.41105 0.000523725 AT5G42510 22.7866 8.55138 -1.41396 0.000523725 AT5G04140 2.07286 0.777123 -1.41541 0.0152294 AT5G47240 2.94615 1.10415 -1.4159 0.000986217 AT2G38750 22.5574 8.441 -1.41811 0.000523725 AT5G62100 2.4547 0.918149 -1.41875 0.000523725 AT4G39320 7.71911 2.88004 -1.42234 0.000523725 AT3G09330 3.18241 1.18699 -1.42282 0.000523725 AT5G53380 5.05906 1.88654 -1.42313 0.000523725 AT4G11170 1.27774 0.476036 -1.42445 0.000523725 AT1G76620 0.670715 0.249545 -1.4264 0.0146576 AT4G14640 11.5246 4.2856 -1.42715 0.000523725 AT4G02290 178.237 66.2399 -1.42803 0.000523725 AT3G32030 6.25903 2.32464 -1.42893 0.000523725 AT1G48660 0.900164 0.334274 -1.42916 0.00661062 AT1G03870 285.403 105.839 -1.43113 0.000523725 AT4G39030 18.4732 6.84838 -1.4316 0.000523725 AT2G34925 3.06568 1.13481 -1.43376 0.013038 AT1G72150 190.829 70.6271 -1.43398 0.000523725 AT4G23020 1.02547 0.379265 -1.435 0.00934061 AT3G09520 0.740452 0.273721 -1.4357 0.00874494 AT3G22415 3.38746 1.25198 -1.43599 0.00934061 AT5G19240 40.7411 15.0145 -1.44013 0.000523725 AT5G60060 2.76305 1.01802 -1.44049 0.000523725 AT5G09520 55.3867 20.4048 -1.44063 0.000523725 AT3G05900 76.6244 28.204 -1.44191 0.000523725 AT3G56230 13.5965 5.00309 -1.44235 0.000523725 AT1G13510 6.57348 2.41393 -1.44527 0.000523725 AT2G40480 31.4495 11.5222 -1.44862 0.000523725 AT5G61440 20.4596 7.46919 -1.45375 0.000523725 AT1G05020 0.865359 0.315597 -1.45522 0.00295584 AT3G55290 3.94001 1.43656 -1.45558 0.000523725 AT4G19720 14.1704 5.1612 -1.4571 0.000523725 AT4G08535 0.814458 0.296344 -1.45857 0.0209838 AT4G13840 1.01211 0.367454 -1.46173 0.00365889 AT1G22740 19.958 7.23327 -1.46425 0.00631038 AT3G28750 1.21411 0.438774 -1.46835 0.013579 AT1G66725 44.364 16.0071 -1.47068 0.00181778 AT3G15760 4.16697 1.50109 -1.47299 0.000523725 AT1G52190 2.32344 0.8365 -1.47382 0.000523725 AT1G60270 4.43264 1.59433 -1.47522 0.000523725 AT1G22530 105.757 37.9252 -1.47953 0.000523725 AT5G41080 39.6329 14.1881 -1.48202 0.000523725 AT3G62930 33.9827 12.1537 -1.4834 0.000523725 AT5G19530 35.8265 12.778 -1.48736 0.00295584 AT3G45080 3.01456 1.07459 -1.48816 0.000523725 AT3G04370 13.3557 4.76049 -1.48827 0.000523725 AT1G63450 7.04527 2.50222 -1.49345 0.000523725 AT1G76020 16.3144 5.79328 -1.49369 0.000523725 AT4G36540 3.07538 1.08887 -1.49793 0.000523725 AT5G54230 11.4486 4.05215 -1.49841 0.000523725 AT1G65484 3.79178 1.34023 -1.50039 0.00501767 AT5G18930 2.12966 0.752566 -1.50073 0.000523725 AT5G65590 1.89597 0.669976 -1.50075 0.0014071 AT1G18140 13.0076 4.59415 -1.50149 0.000523725 AT5G26120 1.87078 0.660642 -1.5017 0.000523725 AT4G01820 0.677755 0.238653 -1.50585 0.000986217 AT4G23070 3.37049 1.18665 -1.50606 0.0246816 AT2G33205 5.12218 1.80234 -1.50689 0.000523725 AT3G26520 995.35 349.232 -1.51102 0.000523725 AT3G46340 1.64841 0.576759 -1.51504 0.000523725 AT4G20390 92.1584 32.2436 -1.5151 0.000523725 AT4G26830 1.20328 0.420263 -1.51761 0.00435758 AT1G06170 1.78667 0.6237 -1.51835 0.000523725 AT4G24670 9.29639 3.24429 -1.51877 0.000523725 AT5G10970 10.7238 3.74089 -1.51937 0.0014071 AT2G31310 5.43037 1.89359 -1.51993 0.00330941 AT2G47010 6.99078 2.43042 -1.52425 0.000523725 AT1G07795 3.15233 1.09588 -1.52432 0.00400116 AT4G01970 7.67458 2.6569 -1.53035 0.000523725 AT5G03545 8.71504 3.01316 -1.53223 0.000523725 AT3G16690 12.3025 4.24653 -1.53459 0.000523725 AT2G05160 2.49177 0.859393 -1.53578 0.000523725 AT1G33440 5.77285 1.98929 -1.53703 0.000523725 AT4G39770 2.92596 1.00564 -1.54079 0.000523725 AT5G64810 11.7193 4.02663 -1.54124 0.000523725 AT1G27140 25.1213 8.61052 -1.54474 0.000523725 AT5G44550 231.107 79.1339 -1.5462 0.000523725 AT4G33330 7.93051 2.71516 -1.54638 0.000523725 AT5G51760 0.68913 0.235806 -1.54718 0.0355455 AT1G19390 0.86198 0.29479 -1.54797 0.00181778 AT2G22510 157.513 53.8163 -1.54935 0.000523725 AT1G51260 2.2644 0.77363 -1.54941 0.000523725 AT3G20460 5.13702 1.75192 -1.552 0.000523725 AT3G26300 12.7913 4.35169 -1.55551 0.000523725 AT1G26360 2.53182 0.857186 -1.56249 0.000523725 AT5G52750 6.73266 2.26706 -1.57035 0.000523725 AT2G44230 12.2884 4.13085 -1.57278 0.000523725 AT5G58360 3.29742 1.1073 -1.5743 0.000523725 AT1G11500 2.42531 0.814261 -1.57461 0.0428761 AT2G46250 0.900818 0.302395 -1.5748 0.00844927 AT5G22530 2.60529 0.873842 -1.576 0.00963516 AT1G09750 15.2766 5.11794 -1.57769 0.000986217 AT5G49340 2.41348 0.807345 -1.57986 0.000523725 AT1G74460 141.287 47.2527 -1.58016 0.000523725 AT2G32530 0.936136 0.312844 -1.58127 0.000986217 AT3G12230 0.857139 0.286339 -1.5818 0.0355455 AT1G13500 2.66546 0.888511 -1.58492 0.00259159 AT1G49200 3.5708 1.18998 -1.58531 0.000523725 AT4G39710 2.52338 0.840702 -1.58569 0.000986217 AT1G31710 16.1447 5.37454 -1.58685 0.000523725 AT2G36430 3.11402 1.03587 -1.58794 0.000523725 AT4G22780 10.7692 3.58146 -1.58829 0.000523725 AT2G28140 7.30561 2.42892 -1.58869 0.000523725 AT5G54790 8.88817 2.94793 -1.59218 0.000523725 AT5G56870 35.664 11.7954 -1.59624 0.000523725 AT1G34500 1.20029 0.396885 -1.5966 0.0404929 AT3G56000 4.77785 1.57911 -1.59725 0.000523725 AT3G59060 0.607296 0.200683 -1.59748 0.013038 AT4G11100 0.945092 0.311687 -1.60036 0.0181532 AT5G14450 10.337 3.40434 -1.60237 0.000523725 AT1G21120 46.8377 15.4088 -1.60391 0.000523725 AT4G28250 150.346 49.3539 -1.60705 0.000523725 AT3G61970 1.10578 0.361956 -1.61117 0.00259159 AT1G14190 6.01401 1.95776 -1.61912 0.00259159 AT3G13810 8.21899 2.67512 -1.61936 0.000523725 AT3G48940 6.2121 2.01564 -1.62384 0.000523725 AT1G03820 43.6796 14.168 -1.62432 0.000523725 AT2G16970 4.18902 1.35401 -1.62937 0.000523725 AT3G19184 2.67099 0.862143 -1.63137 0.000523725 AT4G19050 0.697105 0.224293 -1.63599 0.000523725 AT5G36180 25.1314 8.05537 -1.64147 0.000523725 AT4G28940 47.3121 15.1569 -1.64224 0.000523725 AT1G78020 39.416 12.6262 -1.64236 0.000523725 AT5G37690 110.284 35.1888 -1.64803 0.000523725 AT4G12520 177.824 56.6153 -1.65119 0.000523725 AT5G53250 96.4518 30.6039 -1.65609 0.000523725 AT5G37980 1.11694 0.354142 -1.65715 0.0138333 AT2G41100 113.966 36.0867 -1.65906 0.000523725 AT2G29130 2.14272 0.677796 -1.66052 0.000523725 AT5G26300 6.49739 2.05277 -1.66229 0.000523725 AT2G34420 91.9369 28.9004 -1.66956 0.000523725 AT2G04205 1.94146 0.609438 -1.67159 0.0253893 AT5G58780 20.9492 6.5699 -1.67295 0.000523725 AT1G06923 6.84178 2.14507 -1.67335 0.000523725 AT2G24850 2.03969 0.638931 -1.67462 0.000523725 AT5G58910 5.69892 1.78444 -1.67522 0.000523725 AT1G32450 331.054 103.65 -1.67534 0.000523725 AT2G32140 1.73589 0.543424 -1.67553 0.000523725 AT1G26680 1.85466 0.580044 -1.67692 0.000523725 AT5G45730 2.78073 0.869309 -1.67752 0.000523725 AT1G76100 2.41533 0.753866 -1.67984 0.00501767 AT5G42610 3.53011 1.0996 -1.68274 0.000523725 AT4G33730 15.7638 4.88484 -1.69023 0.000523725 AT5G59680 21.0086 6.50046 -1.69237 0.000523725 AT3G49330 20.2933 6.26752 -1.69504 0.000523725 AT3G63440 3.99972 1.23522 -1.69513 0.000523725 AT3G60120 1.36474 0.421384 -1.69542 0.000523725 AT3G44450 3.36663 1.03943 -1.69552 0.000523725 AT5G44050 1.91774 0.591917 -1.69594 0.000523725 AT4G20230 9.15188 2.80034 -1.70847 0.000523725 AT3G29635 0.663423 0.202691 -1.71065 0.0263674 AT3G47220 12.6425 3.857 -1.71273 0.000523725 AT3G50120 1.4448 0.440547 -1.71351 0.000523725 AT2G18550 3.12494 0.951546 -1.71548 0.000523725 AT5G24910 8.57758 2.59703 -1.72371 0.000523725 AT4G01140 10.397 3.14597 -1.72459 0.000523725 AT3G53960 0.763056 0.230794 -1.72518 0.00631038 AT1G08173 4.21311 1.27354 -1.72604 0.0332044 AT5G60770 6.91407 2.08261 -1.73114 0.000523725 AT3G45280 0.540355 0.162761 -1.73115 0.0362073 AT2G41312 3.62006 1.08904 -1.73295 0.0236792 AT1G22330 8.96769 2.69608 -1.73387 0.000523725 AT4G09110 1.35001 0.40556 -1.73498 0.00566733 AT3G46490 1.0386 0.311962 -1.73519 0.00631038 AT4G18422 4.00778 1.19964 -1.7402 0.0413244 AT1G21110 71.956 21.5379 -1.74024 0.000523725 AT3G61250 0.479492 0.143115 -1.74433 0.0456571 AT1G09350 2.14523 0.637719 -1.75014 0.00295584 AT1G66460 2.89398 0.856339 -1.7568 0.0178879 AT3G43110 8.69773 2.56802 -1.75998 0.000523725 AT1G55990 19.7079 5.81645 -1.76056 0.000523725 AT5G54720 1.22541 0.359485 -1.76926 0.00365889 AT4G15480 18.9111 5.5454 -1.76987 0.000523725 AT5G06475 3.17325 0.930498 -1.76989 0.0488615 AT1G05990 2.36251 0.692055 -1.77136 0.00815255 AT2G27930 6.95248 2.02753 -1.7778 0.000523725 AT5G45650 4.99323 1.45241 -1.78152 0.000523725 AT2G46660 2.92995 0.851515 -1.78277 0.000523725 AT3G26330 18.5874 5.3873 -1.78669 0.000523725 AT5G60660 82.9523 23.9561 -1.79189 0.000523725 AT5G24920 7.03902 2.03277 -1.79192 0.000523725 AT1G56240 2.93695 0.847499 -1.79304 0.000523725 AT4G20450 2.83709 0.815874 -1.798 0.000523725 AT1G77530 9.92266 2.84748 -1.80104 0.0186634 AT4G31940 23.4976 6.73383 -1.80302 0.000523725 AT5G44130 35.7064 10.2219 -1.80452 0.000523725 AT1G02205 1.62059 0.456105 -1.82908 0.000523725 AT2G41510 3.03345 0.852583 -1.83105 0.000523725 AT1G62480 523.013 146.971 -1.83132 0.000523725 AT5G22390 1.61686 0.453575 -1.83378 0.00222163 AT3G11640 1.88582 0.527148 -1.83891 0.0186634 AT5G59370 0.48465 0.13471 -1.84709 0.0378995 AT3G59370 95.1091 26.3983 -1.84914 0.000523725 AT3G56730 6.22057 1.72652 -1.84918 0.000523725 AT5G62165 12.8825 3.57235 -1.85047 0.000523725 AT4G08040 2.68115 0.743161 -1.8511 0.000523725 AT1G67980 1.29218 0.356985 -1.85587 0.0158107 AT3G49110 0.842958 0.232495 -1.85826 0.0160779 AT5G45540 0.458685 0.125888 -1.86537 0.00934061 AT5G39480 0.634134 0.173754 -1.86774 0.0312051 AT5G50140 1.51493 0.413689 -1.87263 0.0014071 AT1G16515 3.0982 0.843695 -1.87664 0.00991024 AT4G27260 13.0191 3.54408 -1.87715 0.000523725 AT5G65230 5.14513 1.39522 -1.88271 0.000523725 AT2G23060 0.72504 0.195941 -1.88764 0.0181532 AT1G30210 11.031 2.9729 -1.89162 0.000523725 AT3G45700 14.4821 3.90211 -1.89195 0.000523725 AT2G23170 3.76865 1.01378 -1.8943 0.000523725 AT4G12980 7.99294 2.14718 -1.89628 0.000523725 AT3G45160 136.521 36.665 -1.89665 0.000523725 AT4G05100 2.59127 0.695773 -1.89697 0.000523725 AT1G78820 2.57185 0.686727 -1.905 0.000523725 AT4G21760 2.93292 0.782857 -1.90552 0.0380758 AT5G44585 8.77092 2.3368 -1.90819 0.000523725 AT4G18390 7.11193 1.89326 -1.90937 0.000523725 AT1G24020 1.39974 0.372604 -1.90944 0.0165975 AT1G26590 1.08041 0.287347 -1.91071 0.00534991 AT5G62330 3.79781 1.00875 -1.91259 0.00786527 AT2G36255 3.37754 0.893944 -1.91772 0.0456571 AT2G44920 0.830298 0.218845 -1.92372 0.0355455 AT4G22640 23.0368 6.06343 -1.92573 0.000523725 AT5G52710 2.47574 0.650542 -1.92815 0.000523725 AT4G11480 1.49157 0.391809 -1.92861 0.000523725 AT3G23120 0.802743 0.210774 -1.92924 0.000523725 AT4G15990 4.22586 1.10846 -1.93068 0.000523725 AT1G13420 25.2305 6.54141 -1.9475 0.000523725 AT3G02493 4.99993 1.29429 -1.94975 0.0256422 AT3G26490 2.51777 0.64939 -1.95499 0.000523725 AT5G54490 6.5117 1.67766 -1.95658 0.000523725 AT4G25100 129.945 33.4227 -1.95901 0.000523725 AT2G45850 0.675734 0.173557 -1.96105 0.00365889 AT5G33355 79.5082 20.4019 -1.9624 0.000523725 AT5G09570 2.81738 0.721873 -1.96454 0.00181778 AT3G46780 1.60347 0.410577 -1.96547 0.000523725 AT2G26750 1.42605 0.365058 -1.96583 0.000986217 AT4G33820 0.826257 0.211189 -1.96806 0.00815255 AT2G45220 137.161 35.0563 -1.96812 0.000523725 AT4G37410 371.649 94.8773 -1.96981 0.000523725 AT5G10100 19.6664 5.01948 -1.97012 0.000523725 AT5G24570 14.8445 3.78746 -1.97063 0.000523725 AT3G06145 4.76915 1.21402 -1.97394 0.000523725 AT5G63160 94.4053 24.026 -1.97427 0.000523725 AT4G23496 17.3235 4.36859 -1.98749 0.000523725 AT4G22666 99.1037 24.9868 -1.98777 0.000523725 AT5G23750 18.3092 4.60089 -1.99258 0.000523725 AT1G05880 1.67768 0.420994 -1.9946 0.000523725 AT4G04840 8.4919 2.11305 -2.00676 0.000523725 AT4G00910 1.4734 0.366347 -2.00787 0.000523725 AT2G22190 6.6753 1.65777 -2.00959 0.000523725 AT1G57670 0.785899 0.194826 -2.01216 0.0316227 AT1G33670 1.81559 0.448694 -2.01663 0.000523725 AT1G62510 5.50437 1.35618 -2.02103 0.000523725 AT2G22920 17.7508 4.36808 -2.02281 0.000523725 AT3G61060 20.5221 5.04671 -2.02377 0.00934061 AT4G35190 1.97906 0.486649 -2.02386 0.00991024 AT2G45660 17.8947 4.39999 -2.02396 0.000523725 AT4G23680 14.3654 3.51928 -2.02924 0.000523725 AT1G01580 52.3202 12.7453 -2.0374 0.000523725 AT1G15625 23.01 5.60493 -2.03749 0.000523725 AT2G01530 307.514 74.4288 -2.04672 0.000523725 AT2G17890 1.02299 0.247548 -2.04701 0.000986217 AT1G02450 2.54331 0.610403 -2.05887 0.0212284 AT1G57980 1.91787 0.459383 -2.06174 0.000523725 AT1G21530 1.19562 0.286375 -2.06178 0.000986217 AT3G46880 7.7295 1.8403 -2.07044 0.0014071 AT3G45680 1.78515 0.423909 -2.07422 0.000523725 AT3G14810 5.94198 1.41005 -2.07519 0.000523725 AT3G12900 9.01564 2.12494 -2.08501 0.000523725 AT1G52560 3.58174 0.841853 -2.08902 0.000523725 AT3G15830 1.40362 0.327631 -2.09901 0.00754938 AT4G35420 10.7349 2.5032 -2.10047 0.000523725 AT3G07970 14.578 3.39557 -2.10207 0.000523725 AT5G15725 4.65592 1.08043 -2.10746 0.00181778 AT1G14120 12.1218 2.80148 -2.11335 0.000523725 AT4G37290 1.72289 0.397436 -2.11604 0.0485395 AT1G71050 1.43087 0.329813 -2.11717 0.0107652 AT2G40130 5.08646 1.16352 -2.12817 0.000523725 AT5G24780 3.04655 0.696572 -2.12883 0.000523725 AT4G11880 15.8831 3.61873 -2.13394 0.000523725 AT5G03435 0.845858 0.192648 -2.13445 0.0014071 AT1G79130 1.76407 0.401382 -2.13586 0.0396231 AT1G34490 1.33345 0.303244 -2.13662 0.0107652 AT5G64687 0.531 0.120122 -2.14422 0.0376746 AT4G26320 165.84 37.4045 -2.14851 0.000523725 AT4G28840 5.05684 1.13689 -2.15314 0.000523725 AT1G19250 8.36567 1.87697 -2.15608 0.000523725 AT2G23130 1.75348 0.39251 -2.15942 0.00295584 AT5G49645 13.2709 2.96867 -2.16038 0.00874494 AT2G25160 17.6808 3.92981 -2.16965 0.000523725 AT1G62500 5.64063 1.2478 -2.17647 0.000523725 AT1G69560 0.661648 0.146045 -2.17965 0.0410968 AT2G29710 3.16225 0.69731 -2.18108 0.000523725 AT1G14700 2.6587 0.585561 -2.18283 0.000523725 AT5G45870 1.82113 0.395896 -2.20164 0.0227018 AT2G23840 0.812729 0.174842 -2.21672 0.0241753 AT3G46400 3.1279 0.671718 -2.21927 0.000523725 AT2G19210 0.810902 0.171837 -2.23848 0.000986217 AT1G62940 0.515213 0.109108 -2.23941 0.0415206 AT1G02575 1.18523 0.250108 -2.24455 0.0158107 AT1G78970 1.86166 0.39233 -2.24645 0.000523725 AT3G02850 14.0241 2.93561 -2.25618 0.000523725 AT4G37390 12.7493 2.66394 -2.25878 0.000523725 AT5G38970 2.72669 0.567638 -2.26411 0.000523725 AT2G38600 14.8202 3.08158 -2.26583 0.000523725 AT2G33850 77.2916 16.0564 -2.26717 0.000523725 AT1G75920 0.510242 0.105281 -2.27694 0.0421685 AT3G18450 24.0093 4.94843 -2.27855 0.000523725 AT1G15260 1.75227 0.35636 -2.29782 0.0124763 AT3G21670 1.79084 0.363448 -2.30081 0.000523725 AT1G21270 0.934487 0.188884 -2.30668 0.0152294 AT1G19050 22.8634 4.62074 -2.30685 0.000523725 AT1G56250 2.33775 0.471726 -2.3091 0.000523725 AT4G00780 1.83435 0.369007 -2.31355 0.000523725 AT5G20790 12.8685 2.57815 -2.31943 0.000523725 AT1G12080 172.906 34.5483 -2.3233 0.000523725 AT4G17340 320.675 63.9367 -2.3264 0.000523725 AT2G20520 4.63075 0.922805 -2.32715 0.000523725 AT4G17680 2.07872 0.4134 -2.33009 0.000523725 AT4G34900 0.79842 0.158732 -2.33055 0.000523725 AT5G20860 6.91239 1.37277 -2.3321 0.000523725 AT4G25830 3.13438 0.621506 -2.33434 0.000523725 AT1G78990 23.6833 4.68484 -2.3378 0.000523725 AT1G67910 9.59367 1.8753 -2.35496 0.000523725 AT1G49450 14.524 2.83567 -2.35668 0.000523725 AT1G66030 2.93302 0.57264 -2.35669 0.013579 AT1G06830 16.7106 3.24282 -2.36544 0.000523725 AT3G45070 45.0114 8.68544 -2.37362 0.000523725 AT4G23670 242.464 46.5412 -2.38119 0.000523725 AT4G32980 0.944304 0.181181 -2.38182 0.000523725 AT5G12280 1.57225 0.300071 -2.38946 0.000986217 AT3G16390 33.3228 6.34843 -2.39204 0.000523725 AT4G22460 62.9013 11.9592 -2.39497 0.000523725 AT1G04240 16.3863 3.09123 -2.40624 0.000523725 AT3G28740 37.5643 7.08189 -2.40716 0.000523725 AT5G10230 18.5643 3.48144 -2.41478 0.000523725 AT4G12510 39.5083 7.40661 -2.41527 0.000523725 AT1G33320 1.31222 0.243179 -2.43192 0.000523725 AT5G60900 0.727063 0.132478 -2.45633 0.000523725 AT5G04370 1.11356 0.20251 -2.45911 0.000523725 AT2G39310 109.187 19.8026 -2.46303 0.000523725 AT5G38020 24.6867 4.4675 -2.46619 0.000523725 AT4G37800 83.9127 15.1503 -2.46954 0.000523725 AT1G10385 1.02983 0.184589 -2.48001 0.000523725 AT3G59340 3.23294 0.578965 -2.4813 0.000523725 AT3G58190 2.79335 0.499103 -2.48459 0.000523725 AT4G04990 7.42856 1.31902 -2.49362 0.000523725 AT5G54710 4.78243 0.844834 -2.501 0.000523725 AT3G16240 188.116 32.945 -2.51349 0.000523725 AT3G51350 31.849 5.57476 -2.51426 0.000523725 AT1G73330 401.668 70.3037 -2.51433 0.000523725 AT1G72140 5.53366 0.964303 -2.52067 0.000523725 AT3G45710 80.6857 14.0203 -2.5248 0.000523725 AT1G28660 3.07798 0.532965 -2.52987 0.000523725 AT3G50560 1.59053 0.275195 -2.53098 0.00400116 AT1G14185 3.10318 0.533528 -2.54011 0.000523725 AT3G51410 0.667147 0.11313 -2.56003 0.00991024 AT1G69230 69.3898 11.6959 -2.56872 0.000523725 AT5G44400 30.1407 5.03922 -2.58044 0.000523725 AT5G56840 1.93281 0.323098 -2.58065 0.00181778 AT4G22217 12.1791 2.03581 -2.58073 0.000523725 AT1G49210 1.42957 0.237635 -2.58877 0.0214594 AT2G01610 18.4442 3.03561 -2.60311 0.000523725 AT3G62760 22.9259 3.74675 -2.61327 0.000523725 AT3G21340 6.15293 1.00164 -2.6189 0.000523725 AT3G57920 2.06649 0.334472 -2.62722 0.0293553 AT3G58000 3.80426 0.610377 -2.63984 0.000523725 AT4G11211 29.1551 4.64719 -2.64932 0.000523725 AT1G18870 1.00649 0.160156 -2.65178 0.000523725 AT1G62975 13.8669 2.19901 -2.65672 0.000523725 AT4G03210 103.539 16.3894 -2.65933 0.000523725 AT5G20410 2.06405 0.319678 -2.69079 0.000523725 AT5G52680 2.5306 0.385139 -2.71603 0.00365889 AT3G62820 2.66784 0.403761 -2.7241 0.000523725 AT5G37990 22.3806 3.38623 -2.7245 0.000523725 AT4G37810 1.50931 0.224424 -2.74959 0.0184226 AT5G24210 0.899304 0.13261 -2.76162 0.00330941 AT3G62750 0.707908 0.0972457 -2.86385 0.000523725 AT5G54700 8.62859 1.17945 -2.87101 0.000523725 AT3G48350 7.11538 0.967899 -2.87801 0.000523725 AT5G24770 10.2329 1.39176 -2.87823 0.000523725 AT2G17040 0.667066 0.0900203 -2.88951 0.0486949 AT5G51780 30.6563 4.03485 -2.9256 0.000523725 AT2G26400 17.7795 2.32931 -2.93224 0.000523725 AT3G56400 6.43944 0.843504 -2.93247 0.000523725 AT4G25410 3.13555 0.399919 -2.97094 0.000523725 AT3G26460 18.7289 2.36889 -2.98299 0.000523725 AT1G17300 20.2648 2.56045 -2.98451 0.000523725 AT1G19900 40.5393 5.1118 -2.98742 0.000523725 AT1G76210 3.3172 0.408894 -3.02017 0.000523725 AT4G16980 13.7074 1.66084 -3.04497 0.000523725 AT1G14960 32.0997 3.85099 -3.05926 0.000523725 AT2G28305 3.30689 0.396133 -3.06142 0.000523725 AT1G16390 4.24743 0.504837 -3.0727 0.000523725 AT1G06120 17.9372 2.12548 -3.07709 0.000523725 AT5G12270 2.66399 0.314526 -3.08234 0.000523725 AT5G24200 1.05066 0.123715 -3.08621 0.00400116 AT1G52800 2.96071 0.342719 -3.11085 0.000523725 AT3G01870 1.02056 0.116377 -3.13249 0.000523725 AT5G52760 3.21043 0.365089 -3.13645 0.000986217 AT3G23290 8.23564 0.933527 -3.14112 0.000523725 AT4G15290 23.9481 2.6842 -3.15735 0.000523725 AT5G47450 58.2551 6.4827 -3.16772 0.000523725 AT3G29410 21.6649 2.39424 -3.17772 0.000523725 AT1G77520 5.98858 0.660441 -3.18071 0.000523725 AT1G58320 6.85366 0.742472 -3.20647 0.000523725 AT4G01890 0.97541 0.105631 -3.20697 0.0107652 AT1G26390 12.8782 1.37201 -3.23057 0.000523725 AT5G50950 0.8812 0.0937244 -3.23297 0.00181778 AT3G60415 4.20159 0.441396 -3.25079 0.000523725 AT4G11210 20.4189 2.07654 -3.29764 0.000523725 AT4G08300 29.444 2.98568 -3.30184 0.000523725 AT2G34490 3.53361 0.358112 -3.30266 0.000523725 AT1G78440 2.83092 0.280555 -3.33491 0.000523725 AT1G63600 1.17864 0.115847 -3.34683 0.0171153 AT1G61130 2.80842 0.274925 -3.35265 0.000523725 AT1G62540 0.989211 0.0961773 -3.36251 0.00181778 AT4G37235 2.07541 0.199304 -3.38035 0.0152294 AT1G70850 805 75.6261 -3.41203 0.000523725 AT2G18470 2.94301 0.271876 -3.43627 0.000523725 AT2G20080 6.6105 0.610106 -3.43763 0.000523725 AT1G71690 1.43395 0.130106 -3.46223 0.0127682 AT3G50160 1.24957 0.112937 -3.46784 0.000986217 AT2G39040 34.6465 3.12178 -3.47227 0.000523725 AT2G42900 4.16631 0.373659 -3.47898 0.000523725 AT1G13710 2.67819 0.23736 -3.49611 0.000523725 AT1G70890 16.0444 1.41727 -3.50088 0.000523725 AT3G29430 6.03364 0.521998 -3.53091 0.000523725 AT4G19925 1.40382 0.117658 -3.57668 0.0444679 AT5G38980 4.06874 0.337079 -3.59342 0.00903988 AT4G22950 2.45396 0.184668 -3.7321 0.0014071 AT5G46900 140.113 10.2687 -3.77027 0.000523725 AT2G39240 0.440467 0.0316359 -3.7994 0.0374873 AT1G11460 2.15353 0.15389 -3.80673 0.0014071 AT5G17700 2.39307 0.170736 -3.80902 0.000523725 AT4G37700 6.70432 0.429452 -3.96452 0.000523725 AT3G30260 3.93401 0.251787 -3.96573 0.000523725 AT1G21250 0.946631 0.0596611 -3.98794 0.00598846 AT3G62740 11.1657 0.667373 -4.06444 0.000523725 AT4G11320 221.492 12.757 -4.11789 0.000523725 AT5G23990 0.909124 0.0486665 -4.22348 0.00435758 AT4G37950 1.00128 0.0526531 -4.24918 0.00598846 AT4G14060 12.0106 0.621951 -4.27136 0.000523725 AT5G13320 2.96913 0.151286 -4.2947 0.000523725 AT1G74670 3.56712 0.171592 -4.3777 0.00934061 AT5G38910 4.05493 0.192466 -4.397 0.00222163 AT1G01680 3.90394 0.170572 -4.51648 0.000986217 AT1G52820 18.1562 0.719361 -4.6576 0.000523725 AT5G46890 196.883 5.09324 -5.27261 0.000523725 AT2G01520 394.474 7.84908 -5.65126 0.000523725