# Source paper archive - Source title: Transcriptome analysis provides insights into candidate genetic regulators of birch response to salt stress - Author(s): Zhi Li, Qingjing Huang, Liangju Li, Lixiu Yan, Bangmeng Zhou, Cheng Jie - Source landing URL: https://www.biorxiv.org/content/10.64898/2026.10.29.762967v1 - PDF URL: https://www.biorxiv.org/content/10.64898/2026.10.29.762967v1.full.pdf - PDF SHA-256: 0b122764e4398ec7863dfd3a5b6bc36572f20983bd3c60d2a2626f82acca5ce1 - Converter: pymupdf4llm 0.0.27 - Limits: Automated PDF text extraction; reading order, equations, tables and formatting may be incomplete or incorrect. Images are omitted, and no OCR was performed. Markup and links are neutralized for safe downloading. Consult the original PDF for the authoritative version. --- [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) # 1 Transcriptome analysis provides insights into candidate genetic 2 regulators of birch response to salt stress 3 Zhi LI [1], Qingjing HUANG [2], Liangju LI [2], Lixiu YAN [2,*], Bangmeng ZHOU [2], Jie CHENG [1,*] 4 _¹Key Laboratory of Meat Processing of Sichuan Province, College of Food and Biological Engineering,_ 5 _Chengdu University, Chengdu 610106, China_ 6 _²Chongqing Academy of Metrology and Quality Inspection, Chongqing 401123, China_ 7 Correspondence: Lixiu YAN (cqjcylx@163.com); Jie CHENG (chengjie@cdu.edu.cn) 8 ORCID: Zhi LI (https://orcid.org/0009-0002-6679-3827); Qingjing HUANG (https://orcid.org/0009-0008-1752 9 9978); Liangju LI (https://orcid.org/0009-0005-7301-4731); Lixiu YAN (https://orcid.org/0009-0001-6016 10 319X); Bangmeng ZHOU (https://orcid.org/0009-0005-5233-0110); Jie CHENG (https://orcid.org/0000-0002 11 0500-4233) 12 1 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 13 Abstract 14 **Background:** Soil salinization is a worldwide matter of concern and can result in a series of 15 agricultural and ecological problems. Previous transcriptome data have shown genetic 16 regulatory mechanisms of salt stress response in _a salt-tolerant species of Betula halophila_ 17 _and a salt-sensitive species of B. platyphylla_, but comparative analysis of transcriptional 18 changes in the the two species remains limited. 19 **Aims:** We compared gene expression in leaves of _B. halophila_ and leaves and roots of _B._ 20 _platyphylla_ . 21 **Methods:** Differentially expressed genes (DEGs) were identified after 24 h of salt stress, 22 followed by Gene Ontology enrichment and gene regulatory network (GRN) construction. 23 Selected DEGs were examined by quantitative real-time PCR (RT-qPCR). 24 **Results:** Compared with 0 h, 956 DEGs were found in _B. halophila_ leaves (BHLeaf), 2,955 in 25 _B. platyphylla_ leaves (BPLeaf), and 3,827 in _B. platyphylla_ roots (BPRoot). BHLeaf DEG 26 expression patterns were similar to those of BPRoot. DEGs from BHLeaf and BPRoot were 27 enriched in cell wall organization or biogenesis, whereas hormone biosynthesis and signaling 28 genes were altered mainly in _B. platyphylla_ . RT-qPCR showed that selected DEGs were 29 induced by 200 mM NaCl for 24 h in _B. platyphylla_ . 30 **Conclusions:** Our work uncovered genetic mechanisms of salt stress response commonly and 31 uniquely occurring in two birch species and provides resources for breeding salt-tolerant 32 birch. ## 33 Highlights 34 - Salt stress altered the expression of 956, 2,955 and 3,827 genes in the two birch species. 35 - BHLeaf expression patterns were similar to those of BPRoot. 36 - The expression changes of nine selected DEGs were examined by RT-qPCR in _B._ 37 _platyphylla._ 2 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 38 **Keywords:** birch; halophytes; glycophytes; transcriptome; salt stress; genetic control 39 **Abbreviations:** BHLeaf, leaves of _B. halophila_ treated with 200 mM NaCl for 24 h; BPLeaf, 40 leaves of _B. platyphylla_ treated with 200 mM NaCl for 24 h; BPRoot, roots of _B. platyphylla_ 41 treated with 200 mM NaCl for 24 h; DEG, differentially expressed gene; FDR, false 42 discovery rate; FPKM, fragments per kilobase per million mapped reads; GO, Gene 43 Ontology; GRN, gene regulatory network; NAA, naphthalene acetic acid; ROS, reactive 44 oxygen species; RT-qPCR, reverse transcription quantitative PCR; SRA, Sequence Read 45 Archive; STEM, Short Time-series Expression Miner; TF, transcription factor; WPM, woody 46 plant medium. 47 **Acknowledgements:** The authors thank the investigators who generated and made publicly 48 available the transcriptome datasets used in this study, as well as the developers of the open 49 source bioinformatics tools used for data analysis. The authors also thank their institutions for 50 providing research facilities and support. No specific funding was received for this study. 51 **Author contributions:** Zhi LI: Conceptualization, Data curation, Formal analysis, 52 Investigation, Methodology, Software, Visualization, Writing—original draft. Qingjing 53 HUANG: Data curation, Formal analysis, Investigation, Validation. Liangju LI: Data 54 curation, Formal analysis, Investigation, Validation. Lixiu YAN: Conceptualization, Project 55 administration, Resources, Supervision, Writing—review and editing. Bangmeng ZHOU: 56 Data curation, Formal analysis, Software, Validation, Visualization. Jie CHENG: 57 Conceptualization, Project administration, Resources, Supervision, Writing—review and 58 editing. All authors read and approved the final manuscript. 59 **Data and materials availability:** The datasets generated and analyzed during the present 60 study are available from the corresponding author on reasonable request. 61 **Declaration of ethical and legal standards compliance:** Not applicable. 62 **Conflict of interest:** The authors declare that they have no conflict of interest. 3 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 63 Introduction 64 More than 20% of the world’s irrigated lands are threatened by high salinity, which is 65 dramatically increasing every year due to climate change and unsustainable irrigation 66 management (Velasco et al. 2018; Singh 2021). High salinity is one of the environmental 67 stressors that severely affects all aspects of plant growth and development (Xiao and Zhou 68 2023). To cope with stress problems in salt-affected problematic soils, plants have evolved 69 diverse physiological and molecular mechanisms during the long period of evolution (Zhao et 70 al. 2020b; Rahman et al. 2022; Thinn et al. 2025). Owing to the degree of tolerance to salt 71 stress, land plants can be mainly divided into glycophytes and halophytes (Flowers et al. 72 2015). For glycophytes, the general limit of external salt concentrations above which plant 73 yield is severely reduced is approximately 86 mM sodium chloride (NaCl) (Chapman 1942), 74 while halophytes are only observed for their yield penalties when the external salt 75 concentrations exceed 200 mM NaCl (Flowers and Colmer 2008; Santos et al. 2016). The 76 halophytic plants which grow in salt-alkalinized habitats are truly salt-tolerant plants, which 77 are provided with the capability of excluding, excreting, and accumulating salts into/from 78 their cells, organelles, and tissues (Shabala 2013; Flowers et al. 2015; Percey et al. 2016). 79 Moreover, external salt concentrations ranged from 40 to 100 mM NaCl severely inhibit 80 photosynthesis in glycophytes (Munns and Tester 2008), while many halophytes are capable 81 of maintaining or improving photosynthesis at these salt concentrations (Stepien and Johnson 82 2009). According to the salt-tolerant characteristics of halophytes mentioned earlier, it is 83 reasonable for us to select them as ideal models to elucidate the mechanisms that underlie 84 salinity tolerance (Fan 2020). 85 In the past decades, it has been well document that plants responding to salt stress involve a 86 variety of biological processes regulated by different functional components, mainly 87 including osmoregulation, ionic homeostasis, oxidation-reduction regulation, antioxidant 4 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 88 enzyme activation, as well as the biosynthesis of hormone and compatible solutes (Munns and 89 Tester 2008; Velasco et al. 2018; Zhao et al. 2020b; Singh 2021). However, the elucidation of 90 contrasting mechanisms underlying salt stress response between halophytes and glycophytes 91 are far from being completely understood. Therefore, it is necessary for us to screen the salt 92 tolerant gene alleles and transform them for the purpose of obtaining salinity-resistant plants 93 with strong acclimation and adaptation to extreme saline environments (Fang et al. 2021). 94 Birch trees ( _Betula spp._ ), widely distributed across Europe and parts of Asia, can thrive in a 95 wide range of habitats from boreal forests to temperate woodlands (Jonczak et al. 2020). The 96 ecological, economic, and evolutionary values of birch trees (Gang et al. 2019), together with 97 their roles in scientific researches, underscore the need for thorough and systematic studies 98 into their growth and developmental properties under normal and stressful conditions. _Betula_ 99 _halophila_, a critically endangered halophytic species, is first discovered in a swamp co 100 occurred with extremely high salinity located in Xinjiang province in 1956 (Shao et al. 101 2018b). _B. platyphylla_, a pioneer hardwood tree species, has exceptional cold tolerance and 102 weak salt resistance (Liu et al. 1998; Chen et al. 2021a). In the present study, we compared 103 the expression alterations of genes across leaves and roots of _B. platyphylla_ as well as leaves 104 of _B. halophila_ . Based on the analysis of differentially expressed genes (DEGs), we proposed 105 the gene regulatory networks (GRNs) to observe how birch seedlings responded to high saline 106 conditions. Furthermore, we randomly selected nine genes from our constructed GRNs and 107 confirmed their expression levels using quantitative real-time polymerase chain reaction (RT 108 qPCR) assay. Our transcriptome analysis explored the genetic regulatory mechanisms 109 involved in salt stress response and discovered a total of potential genes for enhancing salt 110 tolerance in birch, which could lay the foundation for decoding distinct adaptation 111 mechanisms of glycophytes to saline-alkali lands. 5 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 112 Materials and methods 113 **Transcriptome data collection** 114 To understand the transcriptional dynamics of birch seedlings in response to salt stress, we 115 respectively downloaded the transcriptome data of _B. halophila_ (Shao et al. 2018a) and _B._ 116 _platyphylla_ (Jia et al. 2022) from Sequence Read Archive (SRA) data on the National Center 117 for Biotechnology Information (NCBI) website. Of which, the leaves from _B. halophila_ as 118 well as the leaves and roots from _B. platyphylla_ were all subjected to 0 mM NaCl for 0 h and 119 200 mM NaCl for 24 h. Three biological replicates were conducted. In our analysis, the leaves 120 under 200 mM NaCl of _B. halophila_ were designated as BHLeaf. The leaves and roots under 121 200 mM NaCl of _B. platyphylla_ were respectively designated as BPLeaf and BPRoot. 122 **Transcriptome data analysis** 123 We firstly discarded the adaptor sequences and reads with unknown or low-quality bases from 124 raw reads using fastp v0.23.2 (Chen et al. 2018) to obtain clean reads. Clean reads were then 125 mapped to the genome of _B. pendula subsp. pendula_ v.1.2 (Salojärvi et al. 2017) using 126 HISAT2 v2.2.1 (Kim et al. 2019). The transcripts assembly and quantitation were evaluated 127 using StringTie v2.1.3b (Pertea et al. 2016). The gene expression levels were calculated by 128 fragments per kilo-bases per million mapped reads (FPKM) values. We used DESeq2 129 package (Love et al. 2014) to acquire the differentially expressed genes (DEGs). The criterion 130 of false discovery rate (FDR)-corrected P value of 0.05 and an expression value of log � |fold 131 change|>1 was used for judging the significance of expression differences (Benjamini and 132 Yekutieli 2001). Classical Venn diagram was constructed using EVenn online software (Chen 133 et al. 2021b). Heatmaps of gene expression patterns were carried out by pheatmap package 134 v1.0.12 (https://cran.r-project.org/package=pheatmap). Transcription factors (TFs) were 135 annotated and classified by the iTAK online software (Zheng et al. 2016). 6 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 136 **The construction of gene regulatory networks (GRNs)** 137 In our work, genes differentially expressed at one or more tissues from two species were 138 regarded as a gene set. Based on the Short Time-series Expression Miner (STEM) clustering 139 method, clusters were divided by STEM software v1.3.13 (Ernst and Bar-Joseph 2006) with 140 default parameters. Further, we employed the GEne Network Inference with Ensemble of 141 trees (GENIE3) package to construct the potential GRNs related to salt stress. After that, the 142 GRNs were visualized using Cytoscape v.3.10.2 (Shannon et al. 2003). 143 **Gene ontology (GO) enrichment analysis of DEGs** 144 Through homolog searches, we conducted the functional annotation of genes in birch genome. 145 The BLASTP v2.7.1 program was used for searching the Uniprot/SwissProt Release 2021_01 146 (10-Feb-2021) database with parameters including -evalue 1e-5, -num_alignments 1, and 147 outfmt 6. The BLASTP hits with a percentage of identical matches lower than 60% and an 148 alignment length shorter than 70 bp were filtered out. The unique functional annotation of 149 these filtered BLASTP results was regarded as the non-redundant functional annotation 150 database. GO enrichment analysis was carried out using the clusterProfiler package v3.18.0 151 (Yu et al. 2012). 152 **The prediction of homologous genes related to salt stress in birch** 153 Genome files from _Arabidopsis thaliana_ (TAIR10) were downloaded from the Phytozome 154 v13 online website (Goodstein et al. 2012). Genome files of _B. pendula_ v1.2 scaffolds 155 (Salojärvi et al. 2017) were retrieved from the CoGe comparative genomics platform 156 (https://genomevolution.org/CoGe). After that, we performed the OrthoFinder v2.2.7 software 157 (Emms and Kelly 2015) to identify homology relationships between birch and _Arabidopsis_ 158 proteins. In combination with the information of _Arabidopsis_ genes related to salt stress 159 signaling, response, and tolerance reported in public articles, we predicted the birch candidate 160 genes involved in salt stress response. 7 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 161 **Expression patterns of candidate genes related to salt stress response using RT-qPCR** 162 **assay** 163 Micro-propagated plants of _B. platyphylla_ were grown on 6‰ agar-solidified woody plant 164 medium (WPM) with 3.0% sucrose under the pH=5.8. The roots of seedlings were created by 165 WPM medium with the supplement of 1.0 mg/L naphthalene acetic acid (NAA) for 30 d. The 166 culture room parameters were set as follows: 25°C, 16 h of light per day, and light density of 167 approximately 5000 lux. After that, the rooted seedlings were cultivated in the substrates 168 mixed with soils, vermiculites, and perlites for two months under the standard greenhouse 169 conditions. Young seedlings were subjected to 200 mM NaCl solutions for 0 and 24 h. At 170 every time-point, roots and the third leaves close to the apical buds were respectively 171 harvested. Six biological replicates were conducted. 172 RNA extraction and reverse transcription assays were completed according to the protocols 173 described previously (Bian et al. 2025). We randomly selected nine candidate genes related to 174 salt stress response and examined the expression levels of these genes using quantitative real 175 time polymerase chain reaction (RT-qPCR) assay. RT-qPCR assay was accomplished by the 176 PrimerScript RT Reagent Kit (Perfect Real Time, Takara) on a LightCycler [®] 480 II 177 instrument (Roche Diagnostics, Indianapolis, USA). _18S rRNA_ (GenBank Accession #: 178 FJ228477.1) was used as a housekeeping gene. The specific primers of genes used for RT 179 qPCR assay were listed in Table 1. Relative expression levels were calculated using the 2 [−] [ΔΔ] [Ct] 180 method (Schmittgen and Livak 2008). Three replicates were performed for each sample. ## 181 Results 182 **Analysis of genes differentially expressed in** _**B. halophila**_ **and** _**B. platyphylla**_ 183 To study the transcriptional dynamics under salt stress in birch, we downloaded and analyzed 184 the transcriptome data reported by previous studies (Shao et al. 2018a; Jia et al. 2022). 185 Compared to 0 h, there were 339 up-regulated genes and 617 down-regulated genes in 8 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 186 BHLeaf after salt stress for 24 h, 1784 up-regulated genes and 1171 down-regulated genes in 187 BPLeaf after salt stress for 24 h, and 2320 up-regulated genes and 1507 down-regulated genes 188 in BPRoot after salt stress for 24 h (Fig. 1a). These results suggested that after salt treatment, 189 the number of genes differentially expressed in the leaves of _B. halophila_ was similar to that 190 of roots in _B. platyphylla_, while the number of genes with altered expression levels from 191 leaves of two birch species were greatly differed. 192 **Genes related to cell wall organization or biogenesis occurred in leaves of B. halophila** 193 **and roots of** _**B. platyphylla**_ 194 GO enrichment analysis showed that many DEGs from BHLeaf were significantly enriched in 195 cell wall organization or biogenesis (GO:0071554), cell wall organization (GO:0071555), 196 polysaccharide catabolic process (GO:0000272), external encapsulating structure organization 197 (GO:0045229), and pectin catabolic process (GO:0045490) ( _q-value_ <0.05) (Fig. 1b). Many 198 DEGs from BPLeaf were significantly involved in defense response to other organism 199 (GO:0098542) and response to bacterium (GO:0009617) ( _q-value_ <0.05) (Fig. 1b). Many 200 DEGs from BPRoot were significantly related to cell wall organization or biogenesis 201 (GO:0071554), polysaccharide metabolic process (GO:0005976), ion transport 202 (GO:0006811), external encapsulating structure organization (GO:0045229), cell wall 203 organization (GO:0071555), response to inorganic substance (GO:0010035), small molecule 204 biosynthetic process (GO:0044283), cellular carbohydrate metabolic process (GO:0044262), 205 organic acid biosynthetic process (GO:0016053), and carboxylic acid biosynthetic process 206 (GO:0046394) ( _q-value_ <0.05) (Fig. 1b). Accordingly, it seemed that the cell wall 207 organization or biogenesis was a common biological process in the leaves of _B. halophila_ and 208 roots of _B. platyphylla_ exposed to 200 mM NaCl solutions. 209 To further study the DEGs significantly enriched in cell wall organization or biogenesis, we 210 performed the observation on the enzymatic products generated by these DEGs. In our study, 9 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 211 these genes could be classified into two groups (Fig. 1c). Specifically, genes encoding the 212 cellulose synthase, cellulose synthase-like protein, pectin lyase-like protein, pectin 213 methylesterase, pectinesterase, and plant invertase/pectin methylesterase inhibitor protein 214 were associated with the cell wall biosynthesis. Genes encoding leucine-rich repeat/extension, 215 expansin, fasciclin-like arabinogalactan-protein, and galactosyl transferase were in relation to 216 cell wall-localized glycoproteins. In most cases, the expressions of these genes mentioned 217 earlier showed a decrease in leaves of _B. halophila_, while there was an increased expressions 218 of these genes in leaves and roots of _B. platyphylla_ . As a result, it appeared that the opposite 219 expression levels of genes involved in cell wall organization or biogenesis were present in 220 two birch species. 221 **Expression profiles of genes from leaves of B. halophila shared similarity to roots of** _**B.**_ 222 _**platyphylla**_ 223 In the present study, a series of DEGs detected at one or more tissues of two birch species 224 were regarded as a dataset, which was further grouped into 10 clusters by STEM software 225 using the STEM clustering method algorithm (Fig. 2). Among them, the expression profiles of 226 genes from cluster 3, 4, 5, 6, and 9 reached the significant difference ( _p_ < 0.05). Genes from 227 cluster 9 were up-regulated in all tissues of two species, and the expression folds of these 228 genes were increased in leaves and roots of _B. platyphylla_ when compared to the leaves of _B._ 229 _halophila_ . With regards to cluster 3, 5, and 6, the expression levels of genes from leaves of _B._ 230 _halophila_ showed similarity to that of roots of _B. platyphylla_ . Besides, genes from cluster 4 231 exhibited the opposite expression patterns between the tissues of two birch species. Therefore, 232 we proposed that the expression profiles of genes in leaves of _B. halophila_ were similar to 233 that of the roots of _B. platyphylla_, while the expression profiles of genes from leaves of two 234 birch species were greatly differed. 235 To further understand the genes from a certain cluster which biological processes participated 10 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 236 in, we performed GO enrichment analysis (Table 2). In our work, genes from the cluster 3 237 were mainly involved in cell wall organization or biogenesis ( _q-value_ < 0.05). Genes from the 238 cluster 5 were mainly implicated in ribosome biogenesis, response to wounding, as well as 239 defense response to other organism and fungus ( _q-value_ < 0.05). Genes from the cluster 6 240 were mainly related to plastid organization, chloroplast organization, and chloroplast RNA 241 processing ( _q-value_ < 0.05). Genes from the cluster 9 were mainly in relation to 242 photosynthesis, oxylipin biosynthetic and metabolic process, abscisic acid (ABA) response, 243 inorganic substance, and water deprivation ( _q-value_ < 0.05). 244 **Genes responsible for hormone biosynthesis and signaling showed altered expression in** 245 _**B. platyphylla**_ **different from** _**B. halophila**_ 246 On account of the _Arabidopsis_ genes associated with salt stress response, signaling, and 247 tolerance reported in public articles, we found 485 homologous genes from birch genome and 248 224 genes displayed altered expression in one or more tissues of two species after salt stress 249 for 24 h when compared to 0 h (Table 3 and Fig. 3). These results might imply the functional 250 roles of these homologous genes in controlling salt stress response in birch plants. Based on 251 the expression patterns of these genes in two species, we tended to observe whether specific 252 biological processes occurred during salt stress. 253 Of which, nine DEGs (four up-regulated genes and five down-regulated genes), 73 DEGs (52 254 up-regulated genes and 21 down-regulated genes), and 84 DEGs (53 up-regulated genes and 255 31 down-regulated genes) were uniquely present in BHLeaf, BPLeaf, and BPRoot, 256 respectively. Furthermore, nine DEGs from BHLeaf were mainly involved in ABA signaling 257 and response, cytokinin signaling, ionic homeostasis, cell wall integrity, nitrate allocation, and 258 reactive oxygen species (ROS) homeostasis (Table 3 and Fig. 3). 21 DEGs from BPLeaf were 259 mainly involved in cytokinin signaling, auxin signaling and transport, ABA biosynthesis, 260 signaling and response, ionic homeostasis, ROS homeostasis, antioxidant defense, immune 11 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 261 system, peptide transport, cell wall integrity, and ethylene signaling (Table 3 and Fig. 3). 84 262 DEGs from BPRoot were mainly involved in cytokinin signaling, ABA biosynthesis, ABA 263 signaling, ABA response, ionic homeostasis, ROS homeostasis, antioxidant defense, and 264 immune system, peptide transport, cell wall integrity, and gibberellins (GAs) biosynthesis and 265 signaling (Table 3 and Fig. 3). As a result, we thought that the hormone biosynthesis, 266 signaling, and response in most cases was altered in _B. platyphylla_ instead of _B. halophila_ . 267 **Inference of the unique molecular regulatory mechanisms responsible for salt stress** 268 **response in two birch species** 269 We further analyzed the DEGs between two birch species using a Venn diagram (Fig. 4). In 270 our work, 121 DEGs were shared in BHLeaf, BPLeaf, and BPRoot. There were 444, 1877, 271 and 2668 DEGs uniquely present in BHLeaf, BPLeaf, and BPRoot. These results possibly 272 indicated a remarkable difference occurred in different tissues of two birch species subjected 273 to salt treatment. 274 To uncover the candidate genes governing salt stress response in birch, we analyzed the up 275 regulated and down-regulated DEGs uniquely present in BHLeaf, BPLeaf, and BPRoot. Of 276 which, we respectively found 299 (67.34%) down-regulated genes and 145 (32.66%) up 277 regulated genes present in BHLeaf, 848 (45.18%) down-regulated genes and 1029 (54.82%) 278 up-regulated genes present in BPLeaf, as well as 1150 (43.10%) down-regulated genes and 279 1518 (56.90%) up-regulated genes present in BPRoot (Fig. 5a). 280 GO enrichment analysis showed that DEGs uniquely present in BHLeaf were significantly 281 involved in cellular response to phosphate starvation (GO:0016036), cellular response to 282 starvation (GO:0009267), response to nutrient levels (GO:0031667), cellular response to 283 nutrient levels (GO:0031669), response to starvation (GO:0042594), response to extracellular 284 stimulus (GO:0009991), and cellular response to extracellular stimulus (GO:0031668) ( _q-_ 285 _value_ < 0.05); DEGs uniquely present in BPLeaf were significantly related to ribosome 12 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 286 biogenesis (GO:0042254) and ribonucleoprotein complex biogenesis (GO:0022613) ( _q-value_ 287 < 0.05); and DEGs uniquely present in BPRoot were significantly involved in cell wall 288 organization or biogenesis (GO:0071554), polysaccharide metabolic process (GO:0005976), 289 external encapsulating structure organization (GO:0045229), cell wall organization 290 (GO:0071555), cellular carbohydrate metabolic process (GO:0044262), carbohydrate 291 biosynthetic process (GO:0016051), cellular polysaccharide metabolic process 292 (GO:0044264), plant-type cell wall organization or biogenesis (GO:0071669), cell wall 293 biogenesis (GO:0042546), and carbohydrate catabolic process (GO:0016052) ( _q-value_ < 0.05) 294 (Fig. 5b). 295 Gene regulatory networks (GRNs) are powerful abstractions of biological systems (Huynh 296 Thu and Sanguinetti 2019). In this study, we adopted the GENIE3 software to construct the 297 GRNs relevant for salt stress response with the parameters of weight values above 0.01 in two 298 birch species (Fig. 5c, Table 4). The GRN of leaves from _B. halophila_ was consisted of 444 299 genes. Among them, 9 genes showed the closest homology to _Arabidopsis_ genes associated 300 with salt stress response, signaling, and tolerance (Table 3), which included 301 _Bpev01.c0000.g0141_ ( _SnRK2.6/OST1, Sucrose non-fermenting 1 (SNF1)-related protein_ 302 _kinase 2.6/Open stomata 1_ ), _Bpev01.c0052.g0003_ ( _HAK5, High affinity K_ _[+]_ _transporter 5_ ), 303 _Bpev01.c0055.g0015_ ( _NPF7.3/NRT1.5, Peptide transporter family 7.3/Nitrate transporter_ 304 _1.5_ ), _Bpev01.c0136.g0009_ ( _NDL1, N-MYC downregulated-like 1_ ), _Bpev01.c0263.g0010_ 305 ( _ANN4, ANNEXIN 4_ ), _Bpev01.c0479.g0012_ ( _SnRK2.6/OST1_ ), _Bpev01.c0497.g0021_ ( _ARR12,_ 306 _Arabidopsis response regulator 12_ ), _Bpev01.c1067.g000_ 7 ( _CIPK21, Calcineurin B-like_ 307 _protein (CBL)-interacting protein kinase 21_ ), and _Bpev01.c1159.g0015_ ( _LRX4, Leucine-rich_ 308 _repeat extensin 4_ ). These results implied that genes discovered from our GRN of _B. halophila_ 309 probably acted as potential factors in regulating salt tolerance of birch trees. 310 Compared to _B. halophila_, only a few genes were identified from the GRNs of _B. platyphylla_ 13 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 311 (Fig. 5c, Table 5 and S6). Based on the homologous information of _Arabidopsis_ genes 312 associated with salt stress response, signaling, and tolerance reported in public articles (Table 313 3), we found a gene ( _Bpev01.c1966.g0003_ ) encoding UDP-d-xylose 4-epimerase 1/MURUS4 314 (UXE1/MUR4) from the GRN of BPLeaf and a gene ( _Bpev01.c0022.g0007_ ) encoding 315 Histone H1-3 (HIS1-3) from the GRN of BPRoot. These results indicated that the genes 316 identified from our GRNs were possibly capable of salt stress regulation in _B. platyphylla_ . 317 **Prediction of shared genetic regulatory mechanisms controlling salt stress response in** 318 **two birch species** 319 We studied the expression patterns of 121 shared DEGs in two birch species (Fig. 6a). Of 320 which, compared to 0 h, 59 up-regulated genes and 62 down-regulated genes were detected in 321 BHLeaf, 69 up-regulated genes and 52 down-regulated genes in BPLeaf, and 76 up-regulated 322 genes and 45 down-regulated genes in BPRoot. Moreover, in any tissues of two birch species, 323 40 DEGs had decreased expression levels, 25 DEGs showed increased or decreased 324 expression levels, and 56 DEGs exhibited increased expression levels. 325 Further, based on the expression profiles of shared DEGs under the parameter of probability 326 threshold above 0.01, we inferred a common GRN related to salt stress response between two 327 birch species (Fig. 6b, Table 7). Analysis of this shared GRN showed that three TFs, 328 including _Bpev01.c0162.g0014_, _Bpev01.c0088.g0098_, _and Bpev01.c0278.g0038_, were closely 329 homologous to _responsive to desiccation 26_ ( _RD26_ ), _Arabidopsis_ _NAC domain containing_ 330 _protein 2_ ( _ANAC2_ ), and _heat shock transcription factor B2B_ ( _HSFB2B_ ). Additionally, six 331 genes, including _Bpev01.c1292.g0002_, _Bpev01.c0480.g0073_, _Bpev01.c1938.g0005_, 332 _Bpev01.c1798.g0004_, _Bpev01.c0294.g0006_, and _Bpev01.c0452.g0015_, were respectively 333 highly homologous to _EID1-like 3_ ( _EDL3_ ), _domain of unknown function_ ( _DUF23_ ) ( _GALS1_ ), 334 _K_ _[+]_ _efflux antiporter 6_ ( _KEA6_ ), _mitogen-activated protein (MAP) kinase kinase 9_ ( _MKK9_ ), 335 _nine-cis-epoxy-carotenoid dioxygenase 3_ ( _NCED3_ ), and _plant U-box 19_ ( _PUB19_ ). 14 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 336 Accordingly, we suggested that these nine genes might play a critical role in response to salt 337 stress in birch seedlings. 338 **The expression profiles of candidate genes related to salt stress response in birch** 339 To further examine the accuracy of these constructed GRNs responsible for the regulation of 340 salt stress response, we randomly selected nine genes and performed the RT-qPCR assay (Fig. 341 7). In our study, contrary to 0 h, the expression of _Bpev01.c0162.g0014_ ( _RD26_ ), 342 _Bpev01.c0088.g0098_ ( _ANAC2_ ), _Bpev01.c0278.g0038_ ( _HSFB2B_ ), and _Bpev01.c1292.g0002_ 343 ( _EDL3_ ) was activated in roots and leaves treated by 200 mM NaCl for 24 h. Compared to 0 h, 344 the expression of _Bpev01.c0480.g0073_ ( _GALS1_ ) and _Bpev01.c1938.g0005_ ( _KEA6_ ) was 345 inhibited in roots and leaves subjected to 200 mM NaCl for 24 h. After salt treatment for 24 h, 346 _Bpev01.c1798.g0004_ ( _MKK9_ ), _Bpev01.c1966.g0003_ ( _UXE1/MUR4_ ), and 347 _Bpev01.c0022.g0007_ ( _HIS1-3_ ) were weakly expressed in roots and strongly expressed in 348 leaves, as compared to 0 h. Accordingly, we suggested that the genes identified from our 349 GRNs were definitely induced by 200 mM NaCl solutions, involving the involvement of these 350 genes in affecting salt stress response in birch. ## 351 Discussion 352 Salinity is one of the rising problems causing plant yield losses that happens all over the 353 world, especially in arid and semiarid regions (Hassani et al. 2021). To deal with salt damage, 354 it is definitely urgent for us to create salinity-resistant plant varieties through effective genetic 355 engineering strategies. Thus, screening for salt-tolerant gene alleles from halophytes and 356 transforming them into glycophytes grown well in saline soils are of great significance (Yuan 357 et al. 2020). Birch is a pioneer hardwood tree species with ecological, economic, and 358 evolutionary importance due to the presence of strong adaptation to environmental stimuli, 359 outstanding phenotypic characteristics, wood properties, and medicinal uses (Chen et al. 360 2021a). Understanding the interplay between environmental stimuli and genetic factors in 15 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 361 birch plants can allow us to accelerate the genetic improvement of forestry species strongly 362 adapted to salt-affected areas. 363 A series of physiological and molecular mechanisms can be triggered when plants are 364 exposed to high saline solutions (Ding et al. 2024). Unraveling these mechanisms and 365 identifying critical genes involved in salt response are crucial for developing salt-tolerant 366 varieties (Xiao and Zhou 2023). In this study, the number of DEGs discovered in leaves of _B._ 367 _halophila_ showed a decrease as compared to leaves and roots of _B. platyphylla_ . Due to the 368 fact that halophytes are naturally grown in high saline soils, halophytes probably have 369 stronger adaptability to salt stress than glycophytes (Chen and Wang 2024). Once the 370 halophytes are supplemented by high concentrations of NaCl solutions, halophytes enable 371 themselves to maintain the intracellular steady-state level in vivo regardless of dramatic 372 transcriptional changes (Barros et al. 2021). These specific coping strategies to survive salt 373 stress might be the consequence of halophytes and glycophytes having been adapted to 374 distinct natural habitats over a long period of evolution (Acosta-Motos et al. 2017). 375 Meanwhile, the number of down-regulated genes was more than that of up-regulated genes in 376 _B. halophila_, which was probably attributed to halophytes’ ability to homeostasis 377 maintenance at transcriptional levels (Barros et al. 2021). The increased expression folds of 378 genes found in glycophytes as a result of salt stress may be more flexible for them to respond 379 to salt stress than halophytes ( İ brahimova et al. 2021). 380 Salt stress is a major threat to plant growth and developmental activities, which compels 381 plants to initiate multiple salt responsive strategies to promote their survival rates under high 382 saline conditions (Xiao and Zhou 2023; Goudarzi et al. 2024). In our study, the expression 383 profiles of DEGs detected in leaves of _B. halophila_ showed a high similarity to that of roots in 384 _B. platyphylla_, which might be explained by the possibility of their needs to adopt similar 385 responsive mechanisms to overcome salt damage in two birch species. For instance, both of 16 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 386 the halophytes’ leaves and glycophytes’ roots take actions to up-regulate salt stress-related 387 genes to reduce intracellular osmotic potential and maintain water balance, further driving the 388 force to synthesize and accumulate osmoregulatory substances (Cheeseman 2015). Beside, 389 salt stress can disrupt ion homeostasis within plant cells. In order to maintain ion homeostasis, 390 genes related to ion channels and transporters in the leaves of halophytes and the roots of 391 glycophytes can be activated (Bian et al. 2025) Moreover, salt stress can induce a large 392 amounts of ROS accumulation through oxidative stresses (Lodeyro and Carrillo 2015). To 393 address this challenge, the leaves of halophytes and the roots of glycophytes enhanced the 394 activity of antioxidant enzymes and activated the expression of related genes to remove ROS 395 (Rahman et al. 2021). 396 Cell wall is a dynamic and complex structure that surrounds every cell of a plant, which 397 provides both physical support and a means of cell-to-cell communication (Zhang et al. 398 2021a). The composition and structure of cell walls should be tightly regulated to ensure 399 dynamic changes upon encountering environmental stimuli or to meet the needs of the rapidly 400 growing cells (Shao et al. 2018a; Zhang et al. 2021b). High salinity can disrupt cell wall 401 integrity, normal signaling, and nutritional functions (Dabravolski and Isayenkov 2023). In 402 the present study, some DEGs were significantly enriched in cell wall organization or 403 biogenesis in two birch species. Such results might support the viewpoint that plant cell wall 404 is the first line of defense against salt stimulus (Zhang et al. 2021a) and its status is constantly 405 monitored to optimize plant growth and development through influencing a series of stress 406 response mechanisms (Rui and Dinneny 2020). Moreover, we respectively found many genes 407 related to cell wall biosynthesis and encoding cell wall-localized glycoproteins down 408 regulated in _B. halophila_ and up-regulated in _B. platyphylla_, suggesting the occurrence of a 409 decreased cell wall biosynthesis in _B. halophila_ under salt stress. Previous study indicates that 410 a decreased cell wall biosynthesis may be a way for plants to adjust themselves to salt 17 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 411 adaptation (Vaahtera et al. 2019; Ahmad et al. 2023). The defective cell wall biosynthesis 412 makes plants sensitive to salt stress (Zhang et al. 2020; Dabravolski and Isayenkov 2023), 413 which was opposite to our findings of leaves of _B. halophila_ with the supplement of 200 mM 414 NaCl solutions. It is assumed that halophytes and glycophytes probably have developed 415 independent molecular mechanisms to alleviate or eliminate the negative effects of salt stress 416 during the long-term evolutionary process. 417 Accumulating evidences indicate that phytohormones not only control plant growth, 418 development, and productivity under normal conditions but also mediate the sophisticated 419 crosstalk between salinity signals and plant growth adaptation (Yu et al. 2020). Unlike _B._ 420 _halophila_, we found some genes relevant for hormone biosynthesis and signaling displaying 421 altered expressions in _B. platyphylla_, which was likely to imply the presence of postponed 422 hormonal biosynthesis and signaling pathways in leaves of _B. halophila_ supplemented by 423 high saline solutions. Generally speaking, plant hormone-related pathways activated at late 424 stage are beneficial for plants to assess the degree of salt tolerance and optimize resource 425 allocation (Verma et al. 2016). Halophytes can alleviate the detrimental effects caused by salt 426 exposure or re-schedule salt-sensitive developmental stages by the activation of hormonal 427 pathways at late stage (Zhao et al. 2020a). These findings indicated the abnormal hormone 428 biosynthesis and signaling could confer seedlings of _B. halophila_ to have strong adaptability 429 and plasticity in response to salt stress. 430 It is well documented that a wide range of genetic drivers governing salt stress signaling and 431 tolerance have been extensively studied in woody plants (Zhang et al. 2021b), we employed a 432 random forests algorithm to construct several GRNs responsible for decoding the molecular 433 mechanisms underpinning salt stress response of two birch species. In this shared GRN 434 between two birch species, we found nine genes homologous to _Arabidopsis_ genes associated 435 with salt stress response, signaling, and tolerance (Table 3), including _RD26_, _ANAC2_, 18 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 436 _HSFB2B_, _EDL3_, _GALS1_, _KEA6_, _MKK9_, _NCED3_, and _PUB19_ . Researchers have 437 demonstrated that SRM1 ( _Salt-Related MYB1_ ) is a MYB-like transcription factor and plays a 438 negative role in seed germination under saline conditions by regulating the expression levels 439 of _RD26_ in _Arabidopsis_ (Wang et al. 2015). _ANAC2_ is well known as its function in 440 incorporating the salinity stimuli into plant lateral root developmental processes via ethylene 441 and auxin signaling pathways (He et al. 2005). In _Arabidopsis_, _HSFB2B_ represses a morning 442 clock gene _PSEUDO-RESPONSE REGULATOR 7_ ( _PRR7_ ), which functions as a key factor in 443 sustaining the circadian rhythm under high saline conditions (Kolmos et al. 2014). _EDL3_ is 444 presumed to act as a component of an ubiquitin ligase complex that specifically directs 445 negatively acting factors in ABA signaling to degradation via the proteasome, thereby 446 integrating hormone signal transduction towards salt injury (Koops et al. 2011). Galactan 447 synthesized by GALS1 can form the side chains of pectic rhamnogalacturonan I. The 448 excessive accumulation of galactan contributes to the improvement of _Arabidopsis_ plants’ salt 449 tolerance (Yan et al. 2023). In _Arabidopsis_, _histone deacetylase 15_ ( _HDA15_ ) over-expressed 450 transgenic plants exhibit strong salt tolerance by activating an ABA biosynthetic gene _NCED3_ 451 (Truong et al. 2021). Under salt stress, one plant U-box armadillo repeat protein, _PUB19_, can 452 work together with _PUB18_ to inhibit seed germination in _Arabidopsis_ (Bergler and Hoth 453 2011). Expression of active _MKK9_ protein enhances the sensitivity of transgenic seedlings to 454 salt stress, whereas loss of _MKK9_ activity enhances salt tolerance (Xu et al. 2008), indicating 455 a role for _MKK9_ in mediating salt stress response (Xu et al. 2008; Shen et al. 2019; Liu et al. 456 2020). _KEA6_, belongs to _KEA_ family, works coordinately with KEA4, KEA5, _Na_ _[+]_ _/H_ _[+]_ 457 _exchanger 5_ ( _NHX5_ ), and _NHX6_ to facilitate endosomal pH homeostasis and salt tolerance 458 (Zhu et al. 2018). In the present study, we randomly selected several genes and performed the 459 RT-qPCR assay to study their expression profiles under salt stress for 0 and 24 h. According 460 to the RT-qPCR results, _RD26_, _ANAC2_, _HSFB2B_, _EDL3_, and _GALS1_ could be activated or 19 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 461 inhibited by 200 mM NaCl solutions in _B. platyphylla_ . We therefore proposed this shared 462 GRN relevant for unraveling how birch plants reacted to salt stress. Although ecological, 463 physiological, and genetic variations occurred between halophytes and glycophytes, they 464 appeared to share a set of genetic elements to alleviate and endure salt-induced phytotoxicity 465 in birch. 466 Under salt stress, halophytes can activate the expression levels of a large number of genes to 467 maintain the cellular and ionic homeostasis, which is inconsistent with glycophytes (Kumar et 468 al. 2024). In the GRN of _B. halophila_, seven genes were closely homologously to _Arabidopsis_ 469 genes associated with salt stress response, signaling, and tolerance (Table 3), namely 470 _SnRK2.6/OST1_, _HAK5_, _NDL1_, _ANN4_, _ARR12_, _CIPK21_, and _LRX4_ . Given the importance of 471 these genes mentioned above in salt stress control in _Arabidopsis_ (Pandey et al. 2015; Kawa 472 et al. 2020; Zhao et al. 2020a; Gupta et al. 2021; Yan et al. 2021; Liu et al. 2023), it was 473 reasonably thought that our GRN was reliable for addressing the molecular mechanisms 474 underlying salt stress response in _B. halophila_ . Moreover, analysis of the GRNs constructed in 475 _B. platyphylla_ showed that two genes coding for _UXE1_ / _MUR4_ and _HIS1-3_ . Under high salt 476 conditions, _UXE1_ / _MUR4_ has a positive influence on UDP-arabinopyranose biosynthesis 477 during root development (Zhao et al. 2019). The disruption of one linker histone variant 478 _HIS1-3_ can enhance plants’ salt tolerance, leading to the benefits of regulating the 479 transcriptional levels of SOS (salt overly sensitive) genes (Wu et al. 2022). RT-qPCR results 480 showed that these two genes identified from our GRNs could be induced by 200 mM NaCl 481 solutions in _B. platyphylla_ . We therefore suggested that our GRNs in _B. platyphylla_ could 482 make a contribution to explaining the distinctive mechanisms of salt stress response from _B._ 483 _halophila_ . These results further confirmed that during the long-term evolution, halophytes 484 have built diverse regulatory mechanisms to accommodate saline environments by 485 orchestrating the synthesis, signaling, and metabolism of various substances via multiple 20 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 486 pathways (Volkov and Amtmann 2006; Cheeseman 2015; Zhao et al. 2021; Rahman et al. 487 2022; Wang et al. 2023), which exhibited the specific genetic features present in a halophytic 488 species in comparison with a closely related glycophytic species. ## 489 Conclusions 490 One important feature of halophytes is endowed with special morphological, anatomical, and 491 physiological characteristics as well as genetic regulatory networks to well grow and 492 reproduce in high saline soils. Accordingly, halophytes can be selected as a desirable model to 493 uncover the molecular mechanisms underlying salinity tolerance. In our study, the expression 494 patterns of genes in leaves of _B. halophila_ showed a similarity to roots of _B. platyphylla_ . 495 Genes significantly enriched in cell wall organization or biogenesis were detected in leaves of 496 _B. halophila_ and roots of _B. platyphylla_ . Genes related to hormone biosynthesis and signaling 497 were expressed at differential levels in _B. platyphylla_ . Moreover, we respectively revealed the 498 potential molecular mechanisms of salt stress response commonly and uniquely occurring in 499 two species. Our results could explain the salt-resistant variations at the molecular level 500 between _B. halophila_ and _B. platyphylla_, which can provide insights into the genetic control 501 of birch response to salt stress and offer some informative clues to the genetic improvement 502 of glycophytes’ salt tolerance. 21 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 503 References 504 Acosta-Motos J, Ortuño M, Bernal-Vicente A, Diaz-Vivancos P, Sanchez-Blanco M, Hernandez J (2017) Plant 505 responses to salt stress: adaptive mechanisms. Agronomy 7:18. 506 doi:https://doi.org/10.3390/agronomy7010018 507 Ahmad I, Zhu G, Zhou G, Younas MU, Suliman MSE, Liu J, Zhu Ym, Salih EGI (2023) Integrated approaches for 508 increasing plant yield under salt stress. Frontiers in Plant Science 14:1215343. 509 doi:https://doi.org/10.3389/fpls.2023.1215343 510 Barros NLF, Marques DN, Tadaiesky LBA, de Souza CRB (2021) Halophytes and other molecular strategies for 511 the generation of salt-tolerant crops. Plant Physiology and Biochemistry 162:581-591. 512 doi:https://doi.org/10.1016/j.plaphy.2021.03.028 513 Benjamini Y, Yekutieli D (2001) The control of the false discovery rate in multiple testing under dependency. 514 The Annals of Statistics 29:1165-1188. doi:https://doi.org/10.1214/aos/1013699998 515 Bergler J, Hoth S (2011) Plant U-box armadillo repeat proteins AtPUB18 and AtPUB19 are involved in salt 516 inhibition of germination in Arabidopsis. Plant Biology 13:725-730. doi:https://doi.org/10.1111/j.1438 517 8677.2010.00431.x 518 Bian X, Xie T, Chen J, Li C, Yin D, Zhang W (2025) Genome-wide identification of key genes related to chloride 519 ion (Cl−) channels and transporters in response to salt stress in birch. BMC Genomics 26:683. 520 doi:https://doi.org/10.1186/s12864-025-11795-4 521 Chapman VJ (1942) The new perspective in the halophytes. The Quarterly Review of Biology 17:291-311. 522 doi:https://doi.org/10.1086/394660 523 Cheeseman JM (2015) The evolution of halophytes, glycophytes and crops, and its implications for food 524 security under saline conditions. New Phytologist 206:557-570. 525 doi:https://doi.org/10.1111/nph.13217 526 Chen J, Wang Y (2024) Understanding the salinity resilience and productivity of halophytes in saline 527 environments. Plant Science 346:112171. doi:https://doi.org/10.1016/j.plantsci.2024.112171 528 Chen S, Wang Y, Yu L et al. (2021a) Genome sequence and evolution of Betula platyphylla. Horticulture 529 Research 8:37. doi:https://doi.org/10.1038/s41438-021-00481-7 530 Chen S, Zhou Y, Chen Y, Gu J (2018) fastp: an ultra-fast all-in-one FASTQ preprocessor. Bioinformatics 34:i884531 i890. doi:https://doi.org/10.1093/bioinformatics/bty560 532 Chen T, Zhang H, Liu Y, Liu Y-X, Huang L (2021b) EVenn: easy to create repeatable and editable Venn diagrams 533 and Venn networks online. Journal of Genetics and Genomics 48:863-866. 534 doi:https://doi.org/10.1016/j.jgg.2021.07.007 535 Dabravolski SA, Isayenkov SV (2023) The regulation of plant cell wall organisation under salt stress. Frontiers in 536 Plant Science 14:1118313. doi:https://doi.org/10.3389/fpls.2023.1118313 537 Ding C, Yue W, Zhang W, Wang J, Song J, Cui C, Ji G, Ding M, Su X, Zhang H (2024) Physiology and 538 transcriptomics reveal that hybridization improves the tolerance of poplar photosynthetic function to 539 salt stress. Trees 38:95-114. doi:https://doi.org/10.1007/s00468-023-02468-4 540 Emms DM, Kelly S (2015) OrthoFinder: solving fundamental biases in whole genome comparisons dramatically 541 improves orthogroup inference accuracy. Genome Biology 16:157. 542 doi:https://doi.org/10.1186/s13059-015-0721-2 543 Ernst J, Bar-Joseph Z (2006) STEM: a tool for the analysis of short time series gene expression data. BMC 544 Bioinformatics 7:191. doi:https://doi.org/10.1186/1471-2105-7-191 545 Fan C (2020) Genetic mechanisms of salt stress responses in halophytes. Plant Signaling & Behavior 546 15:1704528. doi:https://doi.org/10.1080/15592324.2019.1704528 547 Fang S, Hou X, Liang X (2021) Response mechanisms of plants under saline-alkali stress. Frontiers in Plant 548 Science 12:667458. doi:https://doi.org/10.3389/fpls.2021.667458 549 Flowers TJ, Colmer TD (2008) Salinity tolerance in halophytes. New Phytologist 179:945-963. 550 doi:https://doi.org/10.1111/j.1469-8137.2008.02531.x 551 Flowers TJ, Munns R, Colmer TD (2015) Sodium chloride toxicity and the cellular basis of salt tolerance in 552 halophytes. Annals of Botany 115:419-431. doi:https://doi.org/10.1093/aob/mcu217 553 Gang H, Li R, Zhao Y, Liu G, Chen S, Jiang J (2019) Loss of GLK1 transcription factor function reveals new insights 554 in chlorophyll biosynthesis and chloroplast development. Journal of Experimental Botany 70 555 (12):3125-3138. doi:10.1093/jxb/erz128 22 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 556 Goodstein DM, Shu S, Howson R, Neupane R, Hayes RD, Fazo J, Mitros T, Dirks W, Hellsten U, Putnam N, 557 Rokhsar DS (2012) Phytozome: a comparative platform for green plant genomics. Nucleic Acids 558 Research 40:D1178-D1186. doi:https://doi.org/10.1093/nar/gkr944 559 Goudarzi M, Ismaili A, Sohrabi SS, Nazarian-Firouzabadi F, Eisvand HR (2024) Transcriptomic analysis of salt560 stress-responsive genes in lentil roots and leaves. Plant Biotechnology Reports 18:907-925. 561 doi:https://doi.org/10.1007/s11816-024-00937-x 562 Gupta N, Kanojia A, Katiyar A, Mudgil Y (2021) Molecular characterization of NDL1-AGB1 mediated salt stress 563 signaling: further exploration of the role of NDL1 interacting partners. Cells 10:2261. 564 doi:https://doi.org/10.3390/cells10092261 565 Hassani A, Azapagic A, Shokri N (2021) Global predictions of primary soil salinization under changing climate in 566 the 21st century. Nature Communications 12:6663. doi:https://doi.org/10.1038/s41467-021-26907-3 567 He XJ, Mu RL, Cao WH, Zhang ZG, Zhang JS, Chen SY (2005) AtNAC2, a transcription factor downstream of 568 ethylene and auxin signaling pathways, is involved in salt stress response and lateral root 569 development. The Plant Journal 44:903-916. doi:https://doi.org/10.1111/j.1365-313x.2005.02575.x 570 Huynh-Thu VA, Sanguinetti G (2019) Gene regulatory network inference: an introductory survey. In: Methods 571 in Molecular Biology. Springer New York, pp 1-23. doi:https://doi.org/10.1007/978-1-4939-8882-2_1 572 İbrahimova U, Kumari P, Yadav S, Rastogi A, Antala M, Suleymanova Z, Zivcak M, Tahjib-Ul-Arif M, Hussain S, 573 Abdelhamid M, Hajihashemi S, Yang X, Brestic M (2021) Progress in understanding salt stress response 574 in plants using biotechnological tools. Journal of Biotechnology 329:180-191. 575 doi:https://doi.org/10.1016/j.jbiotec.2021.02.007 576 Jia Y, Zhao H, Niu Y, Wang Y (2022) Identification of birch lncRNAs and mRNAs responding to salt stress and 577 characterization of functions of lncRNA. Horticulture Research 10:uhac277. 578 doi:https://doi.org/10.1093/hr/uhac277 579 Jonczak J, Jankiewicz U, Kondras M, Kruczkowska B, Oktaba L, Oktaba J, Olejniczak I, Pawłowicz E, Polláková N, 580 Raab T, Regulska E, Słowińska S, Sut-Lohmann M (2020) The influence of birch trees (Betula spp.) on 581 soil environment – A review. Forest Ecology and Management 477:118486. 582 doi:https://doi.org/10.1016/j.foreco.2020.118486 583 Kawa D, Meyer AJ, Dekker HL, Abd-El-Haliem AM, Gevaert K, Van De Slijke E, Maszkowska J, Bucholc M, 584 Dobrowolska G, De Jaeger G, Schuurink RC, Haring MA, Testerink C (2020) SnRK2 protein kinases and 585 mRNA decapping machinery control root development and response to salt. Plant Physiology 182:361586 377. doi:https://doi.org/10.1104/pp.19.00818 587 Kim D, Paggi JM, Park C, Bennett C, Salzberg SL (2019) Graph-based genome alignment and genotyping with 588 HISAT2 and HISAT-genotype. Nature Biotechnology 37:907-915. doi:https://doi.org/10.1038/s41587 589 019-0201-4 590 Kolmos E, Chow BY, Pruneda-Paz JL, Kay SA (2014) HsfB2b-mediated repression of PRR7 directs abiotic stress 591 responses of the circadian clock. Proceedings of the National Academy of Sciences 111:16172-16177. 592 doi:https://doi.org/10.1073/pnas.1418483111 593 Koops P, Pelser S, Ignatz M, Klose C, Marrocco-Selden K, Kretsch T (2011) EDL3 is an F-box protein involved in 594 the regulation of abscisic acid signalling in Arabidopsis thaliana. Journal of Experimental Botany 62 595 (15):5547-5560. doi:10.1093/jxb/err236 596 Kumar N, Lata C, Kaur G, Dhansu P, Mann A, Kumar A, Kumar A (2024) Genetic treasures from halophytes: 597 unlocking salt stress tolerance genes. In: Halophytes vis-à-vis Saline Agriculture. Springer Nature 598 Singapore, pp 351-366. doi:https://doi.org/10.1007/978-981-97-3157-2_13 599 Liu G, Liu G, Yang C, Wang H (1998) The analysis for hormonal change and salt-resistant ability of tree species 600 under salt stress. Journal of Northeast Forestry University 26:1-4 601 Liu J, Wang X, Yang L, Nan W, Ruan M, Bi Y (2020) Involvement of active MKK9-MAPK3/MAPK6 in increasing 602 respiration in salt-treated Arabidopsis callus. Protoplasma 257:965-977. 603 doi:https://doi.org/10.1007/s00709-020-01483-3 604 Liu Y, Wu G, Ke X, Zheng Z, Zheng Y (2023) Loss-of-function of ATS1 enhances Arabidopsis salt tolerance. Plants 605 12:2646. doi:https://doi.org/10.3390/plants12142646 606 Lodeyro AF, Carrillo N (2015) Salt stress in higher plants: mechanisms of toxicity and defensive responses. In: 607 Stress Responses in Plants. Springer, Cham, pp 1-33. doi:https://doi.org/10.1007/978-3-319-13368608 3_1 609 Love MI, Huber W, Anders S (2014) Moderated estimation of fold change and dispersion for RNA-seq data with 610 DESeq2. Genome Biology 15:550. doi:https://doi.org/10.1186/s13059-014-0550-8 611 Munns R, Tester M (2008) Mechanisms of salinity tolerance. Annual Review of Plant Biology 59:651-681. 612 doi:https://doi.org/10.1146/annurev.arplant.59.032607.092911 23 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 613 Pandey GK, Kanwar P, Singh A, Steinhorst L, Pandey A, Yadav AK, Tokas I, Sanyal SK, Kim B-G, Lee S-C, Cheong Y614 H, Kudla J, Luan S (2015) Calcineurin B-Like Protein-Interacting protein kinase CIPK21 regulates 615 osmotic and salt stress responses in Arabidopsis. Plant Physiology 169:780-792. 616 doi:https://doi.org/10.1104/pp.15.00623 617 Percey WJ, McMinn A, Bose J, Breadmore MC, Guijt RM, Shabala S (2016) Salinity effects on chloroplast PSII 618 performance in glycophytes and halophytes. Functional Plant Biology 43:1003-1015. 619 doi:https://doi.org/10.1071/fp16135 620 Pertea M, Kim D, Pertea GM, Leek JT, Salzberg SL (2016) Transcript-level expression analysis of RNA-seq 621 experiments with HISAT, StringTie and Ballgown. Nature Protocols 11:1650-1667. 622 doi:https://doi.org/10.1038/nprot.2016.095 623 Rahman MA, Woo JH, Lee S-H, Park HS, Kabir AH, Raza A, El Sabagh A, Lee K-W (2022) Regulation of Na+/H+ 624 exchangers, Na+/K+ transporters, and lignin biosynthesis genes, along with lignin accumulation, 625 sodium extrusion, and antioxidant defense, confers salt tolerance in alfalfa. Frontiers in Plant Science 626 13:1041764. doi:https://doi.org/10.3389/fpls.2022.1041764 627 Rahman MM, Mostofa MG, Keya SS, Siddiqui MN, Ansary MMU, Das AK, Rahman MA, Tran LS-P (2021) 628 Adaptive mechanisms of halophytes and their potential in improving salinity tolerance in plants. 629 International Journal of Molecular Sciences 22:10733. doi:https://doi.org/10.3390/ijms221910733 630 Rui Y, Dinneny JR (2020) A wall with integrity: surveillance and maintenance of the plant cell wall under stress. 631 New Phytologist 225:1428-1439. doi:https://doi.org/10.1111/nph.16166 632 Salojärvi J, Smolander O-P, Nieminen K et al. (2017) Genome sequencing and population genomic analyses 633 provide insights into the adaptive landscape of silver birch. Nature Genetics 49:904-912. 634 doi:https://doi.org/10.1038/ng.3862 635 Santos J, Al-Azzawi M, Aronson J, Flowers TJ (2016) eHALOPH, a database of salt-tolerant plants: helping put 636 halophytes to work. Plant and Cell Physiology 57:e10. doi:https://doi.org/10.1093/pcp/pcv155 637 Schmittgen TD, Livak KJ (2008) Analyzing real-time PCR data by the comparative CT method. Nature Protocols 638 3:1101-1108. doi:https://doi.org/10.1038/nprot.2008.73 639 Shabala S (2013) Learning from halophytes: physiological basis and strategies to improve abiotic stress 640 tolerance in crops. Annals of Botany 112:1209-1221. doi:https://doi.org/10.1093/aob/mct205 641 Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski B, Ideker T (2003) 642 Cytoscape: a software environment for integrated models of biomolecular interaction networks. 643 Genome Research 13:2498-2504. doi:https://doi.org/10.1101/gr.1239303 644 Shao F, Zhang L, Wilson IW, Qiu D (2018a) Transcriptomic analysis of Betula halophila in response to salt stress. 645 International Journal of Molecular Sciences 19:3412. doi:https://doi.org/10.3390/ijms19113412 646 Shao F, Zhang L, Wilson IW, Qiu D (2018b) Transcriptomic Analysis of Betula halophila in Response to Salt 647 Stress. International Journal of Molecular Sciences 19 (11):3412 648 Shen L, Zhuang B, Wu Q, Zhang H, Nie J, Jing W, Yang L, Zhang W (2019) Phosphatidic acid promotes the 649 activation and plasma membrane localization of MKK7 and MKK9 in response to salt stress. Plant 650 Science 287:110190. doi:https://doi.org/10.1016/j.plantsci.2019.110190 651 Singh A (2021) Soil salinization management for sustainable development: a review. Journal of Environmental 652 Management 277:111383. doi:https://doi.org/10.1016/j.jenvman.2020.111383 653 Stepien P, Johnson GN (2009) Contrasting Responses of Photosynthesis to Salt Stress in the Glycophyte 654 Arabidopsis and the Halophyte Thellungiella: Role of the Plastid Terminal Oxidase as an Alternative 655 Electron Sink. Plant Physiology 149 (2):1154-1165. doi:10.1104/pp.108.132407 656 Thinn KSZ, Kim SH, Min J, Oh S-K (2025) Capsicum annum NAC transcription factor CaNAC12 functions as a 657 positive regulator of the stress response to salt, drought, and Botrytis cinerea in Nicotiana 658 benthamiana. Plant Biotechnology Reports 19:43-53. doi:https://doi.org/10.1007/s11816-024-00948 659 8 660 Truong HA, Lee S, TrSnh CS, Lee WJ, Chung E-H, Hong S-W, Lee H (2021) Overexpression of the HDA15 gene 661 confers resistance to salt stress by the induction of NCED3, an ABA biosynthesis enzyme. Frontiers in 662 Plant Science 12:640443. doi:https://doi.org/10.3389/fpls.2021.640443 663 Vaahtera L, Schulz J, Hamann T (2019) Cell wall integrity maintenance during plant development and 664 interaction with the environment. Nature Plants 5:924-932. doi:https://doi.org/10.1038/s41477-019 665 0502-0 666 Velasco J, Gutiérrez-Cánovas C, Botella-Cruz M, Sánchez-Fernández D, Arribas P, Carbonell JA, Millán A, Pallarés 667 S (2018) Effects of salinity changes on aquatic organisms in a multiple stressor context. Philosophical 668 Transactions of the Royal Society B: Biological Sciences 374:20180011. 669 doi:https://doi.org/10.1098/rstb.2018.0011 24 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 670 Verma V, Ravindran P, Kumar PP (2016) Plant hormone-mediated regulation of stress responses. BMC Plant 671 Biology 16:86. doi:https://doi.org/10.1186/s12870-016-0771-y 672 Volkov V, Amtmann A (2006) Thellungiella halophila, a salt-tolerant relative of Arabidopsis thaliana, has specific 673 root ion-channel features supporting K+/Na+ homeostasis under salinity stress. The Plant Journal 674 48:342-353. doi:https://doi.org/10.1111/j.1365-313x.2006.02876.x 675 Wang T, Tohge T, Ivakov A, Mueller-Roeber B, Fernie AR, Mutwil M, Schippers JHM, Persson S (2015) Salt676 related MYB1 coordinates abscisic acid biosynthesis and signaling during salt stress in Arabidopsis. 677 Plant Physiology 169:1027-1041. doi:https://doi.org/10.1104/pp.15.00962 678 Wang X, Chai J, Liu W, Zhu X, Liu H, Wei X (2023) Promotion of Ca2+ accumulation in roots by exogenous 679 brassinosteroids as a key mechanism for their enhancement of plant salt tolerance: a meta-analysis 680 and systematic review. International Journal of Molecular Sciences 24:16123. 681 doi:https://doi.org/10.3390/ijms242216123 682 Wu X, Xu J, Meng X, Fang X, Xia M, Zhang J, Cao S, Fan T (2022) Linker histone variant HIS1-3 and WRKY1 683 oppositely regulate salt stress tolerance in Arabidopsis. Plant Physiology 189:1833-1847. 684 doi:https://doi.org/10.1093/plphys/kiac174 685 Xiao F, Zhou H (2023) Plant salt response: perception, signaling, and tolerance. Frontiers in Plant Science 686 13:1053699. doi:https://doi.org/10.3389/fpls.2022.1053699 687 Xu J, Li Y, Wang Y, Liu H, Lei L, Yang H, Liu G, Ren D (2008) Activation of MAPK kinase 9 induces ethylene and 688 camalexin biosynthesis and enhances sensitivity to salt stress in Arabidopsis. Journal of Biological 689 Chemistry 283:26996-27006. doi:https://doi.org/10.1074/jbc.m801392200 690 Yan J, Liu Y, Yan J, Liu Z, Lou H, Wu J (2023) The salt-activated CBF1/CBF2/CBF3-GALS1 module fine-tunes 691 galactan-induced salt hypersensitivity in Arabidopsis. Journal of Integrative Plant Biology 65:1904692 1917. doi:https://doi.org/10.1111/jipb.13501 693 Yan Z, Wang J, Wang F, Xie C, Lv B, Yu Z, Dai S, Liu X, Xia G, Tian H, Li C, Ding Z (2021) MPK3/6-induced 694 degradation of ARR1/10/12 promotes salt tolerance in Arabidopsis. The EMBO Reports 22:e52457. 695 doi:https://doi.org/10.15252/embr.202152457 696 Yu G, Wang L-G, Han Y, He Q-Y (2012) ClusterProfiler: an r package for comparing biological themes among 697 gene clusters. OMICS: A Journal of Integrative Biology 16:284-287. 698 doi:https://doi.org/10.1089/omi.2011.0118 699 Yu Z, Duan X, Luo L, Dai S, Ding Z, Xia G (2020) How plant hormones mediate salt stress responses. Trends in 700 Plant Science 25:1117-1130. doi:https://doi.org/10.1016/j.tplants.2020.06.008 701 Yuan J, Wang X, Zhao Y, Khan NU, Zhao Z, Zhang Y, Wen X, Tang F, Wang F, Li Z (2020) Genetic basis and 702 identification of candidate genes for salt tolerance in rice by GWAS. Scientific Reports 10:9958. 703 doi:https://doi.org/10.1038/s41598-020-66604-7 704 Zhang B, Gao Y, Zhang L, Zhou Y (2021a) The plant cell wall: biosynthesis, construction, and functions. Journal 705 of Integrative Plant Biology 63:251-272. doi:https://doi.org/10.1111/jipb.13055 706 Zhang H, Zhao Y, Zhu J-K (2020) Thriving under stress: how plants balance growth and the stress response. 707 Developmental Cell 55:529-543. doi:https://doi.org/10.1016/j.devcel.2020.10.012 708 Zhang M, Liu Y, Han G, Zhang Y, Wang B, Chen M (2021b) Salt tolerance mechanisms in trees: research 709 progress. Trees 35:717-730. doi:https://doi.org/10.1007/s00468-020-02060-0 710 Zhao C, Jiang W, Zayed O, Liu X, Tang K, Nie W, Li Y, Xie S, Li Y, Long T, Liu L, Zhu Y, Zhao Y, Zhu J-K (2020a) The 711 LRXs-RALFs-FER module controls plant growth and salt stress responses by modulating multiple plant 712 hormones. National Science Review 8:nwaa149. doi:https://doi.org/10.1093/nsr/nwaa149 713 Zhao C, Zayed O, Zeng F, Liu C, Zhang L, Zhu P, Hsu CC, Tuncil YE, Tao WA, Carpita NC, Zhu JK (2019) Arabinose 714 biosynthesis is critical for salt stress tolerance in Arabidopsis. New Phytologist 224:274-290. 715 doi:https://doi.org/10.1111/nph.15867 716 Zhao C, Zhang H, Song C, Zhu J-K, Shabala S (2020b) Mechanisms of plant responses and adaptation to soil 717 salinity. The Innovation 1:100017. doi:https://doi.org/10.1016/j.xinn.2020.100017 718 Zhao S, Zhang Q, Liu M, Zhou H, Ma C, Wang P (2021) Regulation of plant responses to salt stress. International 719 Journal of Molecular Sciences 22:4609. doi:https://doi.org/10.3390/ijms22094609 720 Zheng Y, Jiao C, Sun H, Rosli Hernan G, Pombo Marina A, Zhang P, Banf M, Dai X, Martin Gregory B, Giovannoni 721 James J, Zhao Patrick X, Rhee Seung Y, Fei Z (2016) iTAK: A Program for Genome-wide Prediction 722 and&#xa0;Classification of Plant Transcription Factors, Transcriptional Regulators, and Protein Kinases. 723 Molecular Plant 9 (12):1667-1670. doi:10.1016/j.molp.2016.09.014 724 Zhu X, Pan T, Zhang X, Fan L, Quintero FJ, Zhao H, Su X, Li X, Villalta I, Mendoza I, Shen J, Jiang L, Pardo JM, Qiu 725 Q-S (2018) K+ efflux antiporters 4, 5, and 6 mediate pH and K+ homeostasis in endomembrane 726 compartments. Plant Physiology 178:1657-1678. doi:https://doi.org/10.1104/pp.18.01053 727 25 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 728 ## 729 Table 730 Table 1 Primer sequences used for RT-qPCR assay. 731 Table 2 GO enrichment analysis of genes in each cluster divided by STEM software. 732 Table 3 Genes related to salt stress response differentially expressed in _B. halophila_ and _B._ 733 _platyphylla_ . 734 Table 4 One inferred GRN relevant for salt stress response uniquely present in leaves of _B. halophila_ . 735 Table 5 One inferred GRN relevant for salt stress response uniquely present in leaves of _B._ 736 _platyphylla_ . 737 Table 6 One inferred GRN relevant for salt stress response uniquely present in roots of _B. platyphylla._ 738 Table 7 One inferred GRN relevant for salt stress response shared in different tissues of _B. halophila_ 739 and _B. platyphylla_ . 740 26 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 741 Figure legends 742 Fig. 1 Analysis of DEGs in _B. halophila_ and _B. platyphylla_ . a, Number of up-regulated and down 743 regulated genes in BHLeaf, BPLeaf, and BPRoot. b, GO enrichment analysis of DEGs in BHLeaf, 744 BPLeaf, and BPRoot. The 10 most represented GO terms are shown. c, Expression patterns of DEGs 745 significantly enriched in cell wall organization or biogenesis. 746 Fig. 2 Cluster analysis of DEGs detected in one or more tissues of _B. halophila_ and _B. platyphylla_ . The 747 expression levels were represented by log 2 FC. 748 Fig. 3 Analysis of DEGs uniquely identified in different tissues of _B. halophila_ and _B. platyphylla_ . 749 Details of these genes are listed in Table S3. 750 Fig. 4 Venn diagram analysis of DEGs among different tissues of two birch species. 751 Fig. 5 Analysis of DEGs uniquely present in _B. halophila_ or _B. platyphylla_ . a, Number of up-regulated 752 and down-regulated genes uniquely present in BHLeaf, BPLeaf, and BPRoot. b, GO enrichment of 753 DEGs uniquely present in BHLeaf, BPLeaf, and BPRoot. The 10 most represented GO terms are 754 shown. c, Inferred GRNs involved in salt stress response of two birch species. The connectivity of 755 gene to gene was screened by the threshold of weight values more than 0.01. The red circles 756 represented birch genes showing the closest homology to _Arabidopsis_ genes related to salt stress 757 reported in public articles. The black squares represented TFs. 758 Fig. 6 Analysis of shared DEGs between _B. halophila_ and _B. platyphylla_ . a, Expression patterns of 759 shared DEGs among BHLeaf, BPLeaf, and BPRoot. HD-ZIP, Homeodomain-leucine zipper 760 transcription factor; NAC, Petunia no apical meristem and ATAF1, ATAF2, and CUC2; ERF, 761 Ethylene response factor; bZIP, Basic region/leucine zipper motif transcription factor; Dof, DNA 762 binding with one finger transcription factor; MYB, Myeloblastosis; C2H2, Cys2His2-type zinc-finger 763 transcription factor; HSF, Heat shock transcription factor. b, Inferred GRN involved in salt stress 764 response commonly present in _B. halophila_ and _B. platyphylla_ . Genes homologous to _Arabidopsis_ 765 genes related to salt stress signaling and tolerance were marked in blue. 766 Fig. 7 Expression profiles of candidate genes related to salt stress response in birch using RT-qPCR 767 assay. 768 27 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) ## 769 Tables 1-7 in supplementary materials **Table 1 Primer sequences used for RT-qPCR assay.** Gene ID (Gene name) Primer sequences (5'~3') F: GTAAGCCTCAACTCGGTGC _Bpev01.c0162.g0014 (RD26)_ R: CGAGTTATCGATCCGCTGAG F: CGTGTACTTCGACACGTCGG _Bpev01.c0088.g0098 (ANAC2)_ R: GGGCTTCTGCATGTACATGAAC F: GGTGGCGGTGCACCGG _Bpev01.c0278.g0038 (HSFB2B)_ R: GTACAGAAGCTCCGGTACCG F: GACGGCAGGTAGCGCTGG _Bpev01.c1292.g0002 (EDL3)_ R: CAATCACGCCGACCCCACC F: CGCCGCCGCTCTGTTCGT _Bpev01.c0480.g0073 (GALS1)_ R: CAGGGAAGGTGCAGTTGAC F: GATCTCCGTCGTCGGAGC _Bpev01.c1938.g0005 (KEA6)_ R: CACTGTTATTGAAGCCTCCAGC F: GGCAGTTGTTCGAGAACGG _Bpev01.c1798.g0004 (MKK9)_ R: CATAGAAAGCGCTGGTGCGC F: GCTAAATTTTGGCAGGTCCAG _Bpev01.c1966.g0003 (UXE1/MUR4)_ R: CCAATATAGCCAGCACCTCCTG F: CGTACAAGCTCTCCCTGGTG _Bpev01.c0022.g0007 (Histone H1-3)_ R: CGTACTCGCCTTCCTCTTCG F: ATCTTGGGTTGGGCAGATCG _FJ228477.1 (18S rRNA)_ R: CATTACTCCGATCCCGAAGG 28 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 770 771 Fig. 1 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 772 773 Fig. 2 774 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 775 776 Fig. 3 777 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 778 779 Fig. 4 780 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 781 782 Fig. 5 783 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 784 785 Fig. 6 786 [bioRxiv preprint doi: https://doi.org/10.64898/2026.10.29.762967; this version posted November 2, 2026. The copyright holder for this preprint](https://doi.org/10.64898/2026.10.29.762967) (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made [available under a CC-BY 4.0 International license.](http://creativecommons.org/licenses/by/4.0/) 787 788 Fig. 7